Labshake search
Citations for Roche :
101 - 150 of 5049 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: TUNEL staining was performed using the In Situ Cell Death detection kit (Roche Diagnostic, USA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: Cell viability staining was performed using the In situ cell death detection kit (Roche Diagnostic). In summary ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell apoptosis was detected by TUNEL assay with In Situ Cell Death Detection Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: TUNEL analysis was performed using In Situ “Cell Death Detection Kit” (TMR Red) (Roche, #12156792910).
-
bioRxiv - Developmental Biology 2024Quote: ... Apoptosis staining was done using TMR red In Situ Cell Death Detection Kit (121567910, Roche). Brain sections (5 um ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TUNEL assay was performed using the In Situ Cell Death Detection Kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... TUNEL staining was performed using the In Situ Cell Death Detection Kit (Roche, Cat #11684817910) according to the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2024Quote: ... rinsed in PBS and treated using a In Situ Cell Death AP kit (Roche 11684809910). Following those labelling ...
-
bioRxiv - Developmental Biology 2021Quote: ... Apoptotic cells were identified by using an in situ cell death detection kit (Roche, catalog #11684795910) according to the manufactureŕs instructions ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescent TUNEL staining was performed using the Fluorescein In Situ Cell Death Detection Kit (11684795910, Roche), with the fluorescein detected by antibody staining using rabbit anti-FITC ...
-
bioRxiv - Cell Biology 2020Quote: ... TUNEL staining was performed according to manufacturer’s guideline (In-Situ Cell Death Detection Kit, Fluorescein, Roche). All staining was performed on 3 hearts per group ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptotic cells were examined with Roche in situ cell death detection kit (Roche Applied Science, 11684795910) according to instructions and followed by DAPI (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... was performed with the In Situ Cell Death Detection Kit/Fluorescein (Roche, 11 684 795 910). Slides were first pretreated with a 2:1 mix of Ethanol:Acetic Acid 5min -20C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptosis was analyzed using TUNEL assay by an In Situ Cell Death Detection kit (11684795910, Roche). As counterstain for IF and IHC stainings Hoechst or DAPI staining was used ...
-
bioRxiv - Cell Biology 2021Quote: Apoptosis in kidneys was detected using the In Situ Cell Death Detection Kit (Sigma Aldrich/Roche). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... assays were carried out using the in Situ Cell Death Detection Kit (11684795910; Roche, Basel, Switzerland) as previously described (Liu et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with In Situ Cell Death Detection (TUNEL) Kit with TMR Red (Roche, 12156792910) according to the vendor’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Cell death was determined by lactate dehydrogenase (LDH) activity using a Cytotoxicity Detection Kit (LDH) (Roche). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... The brain slices were processed using the In Situ Cell Death Detection Kits (Roche Life Science) according to manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: To detect DNA fragmentation in GFAP+ astrocytes an in situ cell death detection kit (Roche, 11684795910) was used ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and apoptosis was detected using in situ cell death detection kit (TMR Red; Roche, Indianapolis, IN). Nuclei were visualized using DAPI ...
-
bioRxiv - Molecular Biology 2023Quote: ... For detection of in situ cell death (Roche), sections were processed for proteolytic digestion with proteinase K (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... and BCL2 used in combination with FastStart TaqMan® Probe Master solutions (Roche Diagnostics, Sussex, UK). Individual sample mRNA levels were analysed in triplicate in a 96-well plate using an LC480 light cycler instrument (Roche Diagnostics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the CAT ELISA kit (Roche, cat. # 11758241001). The ratios of CAT/βGAL were then analyzed to calculate the relative IRES activity.
-
bioRxiv - Cancer Biology 2021Quote: ... T7 promoter sequences (Roche) were added to one side of the PCR product during this PCR amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using In Situ Cell Death Detection Kit (TMR red cat no. 1684795, Roche, Indianapolis, IN, USA) according to manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2021Quote: ... TUNEL staining was performed according to manufacturer’s instructions (In situ cell death detection kit TMR red, Roche). For the positive control ...
-
bioRxiv - Developmental Biology 2020Quote: ... TUNEL stainings were performed as IF experiments with the TMRRed In situ dell death detection kit (Roche).
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... TUNEL apoptosis assay was performed on embryos with the In-Situ Cell Death Detection kit (POD: Roche) according to the manufacturer’s recommendations at 37°C for 5 hours ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... blastocytes were subject to the TUNEL reaction using the In-Situ Cell Death Detection Kit (Roche, 11684809910) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: TUNEL assay was carried out following the manufacturer’s instructions (In Situ Cell Death Detection Kit, Roche-11684795910).
-
bioRxiv - Developmental Biology 2024Quote: ... TUNEL staining was performed following the in situ cell death detection kit (Roche Applied Science, Indianapolis, IN). All commercial antibodies were validated by vendors ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... apoptotic cells in pancreas frozen sections were detected by the TUNEL (TdT mediated dUTP nick end labeling) assay using a fluorescein-based detection kit (in situ death detection kit, Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: The TUNEL staining was performed using an In Situ Cell Death Detection Kit (Roche Diagnostics GmbH, Mannheim, Germany). The paraffin sections were stained with TUNEL reaction mixture for 1 h at 37°C and then mounted using DAPI containing mount medium ...
-
bioRxiv - Neuroscience 2022Quote: ... Afterwards samples were incubated for 2 h in the In Situ Cell Death Detection Kit (Roche, Basel, Switzerland) enzyme labeling solution at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The assay was performed using the In Situ Cell Death Detection (TUNEL) Kit with TMR Red (Roche, 12156792910) as previously described13 ...
-
bioRxiv - Physiology 2023Quote: ... the terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) in situ cell death detection kit (Roche, Basel, Switzerland) was used according to the manufacturer’s instructions (including incubation for 1 h at 37 °C) ...
-
bioRxiv - Neuroscience 2023Quote: TUNEL staining was performed for paraffin sections using the In Situ Cell Death Detection Kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: The TUNEL assay was performed in cryosectioned lung tissue using the In Situ Cell Death Detection Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and then stained using the in situ TMR red cell death detection kit (Roche Applied Science, cat#: 12156792910) [39] ...
-
bioRxiv - Systems Biology 2024Quote: Paraffin-embedded tissue sections were processed with an in-situ cell-death detection kit (11684795910; Roche, Basel, Switzerland) for terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling ...
-
bioRxiv - Biochemistry 2021Quote: The Telo TAGGG Telomerase PCR ELISA kit (Roche, Basel, Switzerland) was used to detect the telomerase activity of keratinocytes after UV irradiation ...
-
bioRxiv - Molecular Biology 2020Quote: Cryosections (10μM) of ventricular tissue were fixed in 4% paraformaldehyde and stained with In-situ Cell Death Detection kit (Roche). Sections were imaged on a laser-scanning confocal microscope (LSM 510 ...
-
bioRxiv - Genetics 2020Quote: ... Staining for apoptotic cells was performed using the AP-In situ Cell Death Detection Kit (Roche Diagnostics, Penzberg, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... NPCs were washed by phosphate buffer saline (PBS) and stained by in situ Cell Death Detection Kit (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TUNEL reaction was performed in a humid chamber for 2.5 h at 37 °C with the in Situ Cell Death Detection Kit (Roche) using 100 μL of reaction mixture per slide ...
-
bioRxiv - Developmental Biology 2022Quote: Apoptosis in the migrating primordium was identified using terminal transferase-mediated dUTP nick end-labeling (TUNEL) assay according to manufacturer’s instruction with minor modifications (In situ Cell Death Detection Kit, TMR Red, Roche). Embryos at 30-42 hpf were dechorionated and fixed in 4% PFA overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: TUNEL assay (90) was performed using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Cell Biology 2020Quote: ... Apoptotic cells were detected in dissected guts using the TMR red In Situ Cell Death Detection Kit (Roche; 12156792910) following standard kit staining protocol ...