Labshake search
Citations for Roche :
101 - 150 of 8180 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Genomics 2020Quote: ... all multiplexed single-cell libraries (n = 30) were quantified using the KAPA Library Quantification Kit for Illumina Platforms (Roche) and pooled in an equimolar ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was incubated for o/n with 40μl of anti-HA agarose beads (rat anti-HA, 3F10 Roche) at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg of total RNA was separated on a denaturing 1.2% agarose gel and blotted on a Hybond-N+ (Roche) membrane ...
-
bioRxiv - Microbiology 2020Quote: ... separated by electrophoresis in a 0.8% agarose gel and transferred onto a nylon membrane (Hybond N+, Roche Molecular Biochemicals). The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Genetics 2020Quote: ... pellets were thawn and re-suspended in 400 μl of lysis buffer (50mM HEPES pH7.5, 150mM NaCl, 5mM MgCl2, 40mM N-Ethylmaleimide, EDTA-free protease inhibitor cocktail (Roche) and 2mM PMSF (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Biochemistry 2020Quote: ... Trypsin-6 (11418025001; Roche), Trypsin-7 (90057 ...
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with 250-800 ng DNA per well of a 12-well plate or 500 ng per well of a 6-well plate using X-tremeGENE 9 DNA transfection reagent (Roche), and harvested after 24 h.
-
bioRxiv - Neuroscience 2021Quote: ... COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X-tremeGENE™ 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirAER (1 μg/well) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with 1 μg Kras or control expression plasmid and 1 μg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 μl of X-tremeGENE 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with 1 ug of shRNA/cDNA and 1 ug of viral packaging plasmids (250ng pMD2.G and 750ng psPAX2) using 6 ul of Xtreme Gene 9 transfection reagent (Roche). After 24 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with 1 µg of shRNA/cDNA and 1 µg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 µl of Xtreme Gene 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Cell Biology 2023Quote: RPE-1 cells were trans-fected with the different Flag constructs for 48 h using X-tremeGENE 9 DNA reagent (Roche). Cells were lysed in 25mM Tris (pH 7.5) ...
-
bioRxiv - Cell Biology 2019Quote: ... hypervirulent M.tb infected and uninfected macrophages using calibrated normalised relative quantities using the equation N = N0 x 2Cp (LightCycler®96 software, Roche). All qPCRs were done on RNA extracted from three separate experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... FISH signal was developed with tyramide reaction following O/N incubation of embryos in sheep anti-DIG antibody (Roche; Cat#11222089001) (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... N-glycans were released directly using cartilage lysates following deglycosylation by overnight treatment with peptide N-glycanase F (PNGase F, 2U) (Roche, Switzerland). The supernatants containing GSLs and fOSs were dried with a centrifugal evaporator ...
-
bioRxiv - Cancer Biology 2020Quote: ... Fugene 6 transfection reagent (Roche) was used for all other transfection experiments.
-
bioRxiv - Molecular Biology 2019Quote: ... 6 mM creatine phosphate (Roche), 102 ng/µl creatine kinase (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6 mM creatine phosphate (Roche), 102 ng/µl creatine kinase (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg/ml Bevacizumab (Roche) was administered ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Microbiology 2020Quote: Adherent macrophages in 6-well plates were washed with PBS containing 1 mM sodium orthovanadate and 10 mM 1,10-phenanthroline (Roche) on ice prior to lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transiently transfected for 24 h with 9,36 μg of hNAA40-flag expression vectors and using 35 μl Fugene HD (Roche, cat. n°04709705001) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: We then targeted the N-(nucleoprotein) gene of SARS-CoV-2 virus with Roche Lightcycler 480 RNA Master Hydrolysis Probes (Roche Basel, Switzerland) with primers developed in house ...