Labshake search
Citations for Roche :
101 - 150 of 737 citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Neuroscience 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate, Roche 11383221001). Larvae were mounted in 100% glycerol under coverslips and bright-field images captured using a Leica DFC500 camera mounted on a Zeiss Axioskop
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Developmental Biology 2024Quote: ... Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Roche) and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche). After centrifugation at 400g for 5 min at 40C ...
-
bioRxiv - Genomics 2020Quote: ... Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) were used for the colorimetric detection of alkaline phosphatase activity ...
-
bioRxiv - Biochemistry 2020Quote: ... blocked in 3% BSA and probed with anti-HA (clone 12CA5, Roche), anti-cMyc (clone 9E10 ...
-
bioRxiv - Neuroscience 2020Quote: ... Following resuspension in (3 ml) homogenization medium containing protease inhibitor (Roche Diagnostics), the cells were cracked open using a ball bearing homogenizer with a 0.2507-inch bore and 0.2496-inch diameter ball ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 1/3 of a Complete EDTA-free protease inhibitor cocktail tablet (Roche) and were lysed by five passes through an Avestin C3 homogenizer at 15-20,000 PSI ...
-
bioRxiv - Cell Biology 2020Quote: ... The cartilage was then incubated in 3 mg/mL Collagenase D (Roche) in DMEM solution for two 45 minute periods and transferred to 0.5 mg/mL Collagenase D in DMEM solution supplemented with 3% Liberase TL (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei lysates (in Nuclear Buffer Lysis 3, supplemented with protease (Roche, 11697498001) and phosphatase inhibitors (1 mM Na3O4V (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5-bromo-4-chloro-3’-indolyphosphate (NBT/BCIP) and FastRed (Roche, Germany) staining was performed according to established published protocols62,63 using the following DIG and FITC labeled probes:
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche, KK2502) were added to the annealed oligos ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 175 µg/mL 5-bromo-4-chloro-3’-indolyl-phosphate (Roche). Embryos were cleared in 70% glycerol overnight and imaged using Leica M205FA microscope ...
-
bioRxiv - Microbiology 2024Quote: ... 3 mM MgCl2) supplemented with complete Protease inhibitor cocktail tablets (Roche 11873580001). The lysates were incubated on ice for 1 hour and centrifugated at 20,000 x g for 15 minutes at 4°C to pellet the nuclear fraction ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5-bromo-4-chloro-3- indolyl phosphate (BCIP) (Roche Diagnostics, Switzerland) were used as substrates and incubated for 10 minutes or till positive signals on sense/anti-sense probes are seen ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Developmental Biology 2021Quote: ... 3 % SDS with protease inhibitors (cOmplete Mini EDTA-free Protease Inhibitor Cocktail, Roche) at room temperature for 1 hour in a total volume of 3 mL ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted in PBS containing 3% Bovine Serum Albumin (BSA; Roche Diagnostics, Basel, Switzerland), were applied onto the coverslips and incubated for 1 h at RT ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...