Labshake search
Citations for Roche :
101 - 150 of 2344 citations for 2 3 Dimethyl 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Cell Biology 2021Quote: ... Cardiac tissue sections were either stained for 5-bromo-4-chloro-3-indolyl-b-galactosidase (Xgal; Roche Cat #XGAL-RO) or immunostained with rabbit anti-mouse polyclonal Ror2 (provided by Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was hybridized with a TAA(CCCTAA)4 probe which was conjugated with digoxigenin (DIG oligonucleotide 3⍰-end labelling kit, Roche) and signal was revealed using the anti-DIG-alkaline phosphatase antibodies (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... Alkaline phosphate labeling was detected by incubation overnight at room temperature in the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with levamisole (Sigma) ...
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Cell Biology 2022Quote: ... Analysis was performed on either an LSRII 3 or 4-laser flow cytometer (Becton Dickinson) or Attune Acoustic Flow Cytometer (Roche). Post analysis was performed using either FACSDiva (BD) ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... the slides were incubated for ∼72 hours at 37°C in staining solution containing nitro blue tetrazolium and 5- bromo-4-chloro-3-indolyl-phosphate (Roche). The slides were finally washed ...
-
bioRxiv - Cell Biology 2024Quote: ... the digestion with 3 mg/mL type I collagenase was performed in parallel to and compared with 3 mg/mL type I collagenase + 4 mg/mL type II Dispase (Roche), 250 μg/mL Liberase DL (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...