Labshake search
Citations for Roche :
101 - 150 of 1900 citations for 2 6 Amino 9H purin 9 yl ethanol d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... ethanol precipitated in the presence of glycogen (20 mg/mL, Roche), and resuspended in 10 μLubi of 10 mM Tris buffer (pH 7.5) ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Y-27632 was sourced from Selleckhem and 4’,6-diamidino-2-phenylindole (DAPI) was obtained from Roche. Colony formation assays were conducted with 2×103 cells in 6-well petri dishes subjected to treatments as indicated in the Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... or X-Treme transgene 9 transfection reagent (Roche, Basel, Switzerland), according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected using X-tremeGENE 9 transfection reagent (Roche). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell line using X-tremeGENE 9 DNA transfection reagent (Roche). 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using X-tremeGENE 9 DNA transfection reagent (Roche, cat# 6365779001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded and transfected using XtrememGene 9 (Roche, USA) according to manufacturer’s manual 48 h prior to infection ...
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Microbiology 2021Quote: ... and ethanol (2x volume) precipitation with 0.1 µg/µL glycogen (Roche diagnostics) via ethanol precipitation ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and Lactate dehydrogenase (LDH) assay kit (LDH Cytotoxicity Detection KitPLUS) were obtained from Roche (Germany). MG-63 cell line (National Cell Bank of Iran (NCBI) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Immunology 2024Quote: ... was transfected into HEK293T cells using X- tremeGENE™ 9 (Roche) with psPAX2 (1.625 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... phenol-chloroform extraction and ethanol precipitation in presence of 20 µg glycogen (Roche). Input material (1.5% ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells fixed overnight in 70% ethanol were stained with propidium iodide (Roche #11348639001) and filtered to remove cell aggregates immediately prior to analysis by Flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... a subsequent ethanol precipitation step with glycogen from mussels (Roche Diagnostics, Basel, Switzerland) as carrier molecule was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... and ethanol precipitation and was further purified with KAPA Pure beads (KAPA Biosystems).
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...