Labshake search
Citations for Roche :
101 - 150 of 8496 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 2 mM Dithiothreitol (DTT)) supplemented with protease inhibitor cocktail (Roche) and lysed by sonication on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5-Bromo-2’-deoxy-uridine Labelling and Detection Kit II (Roche, UK) was used per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... determined as the amount of 5-bromo-2′-deoxy-uridine (BrdU) incorporation (Roche BrDU Labeling and Detection Kit II ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... HepG2s were washed once with 1X PBS then lysed in SDS lysis buffer (50 mM Tris HCl/2% SDS/5% glycerol/5 mM EDTA/1mM NaF/dH2O) supplemented with cOmplete Protease Inhibitor Cocktail Tablets (Roche #11836170001), Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich® #P5726) ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... proliferation was measured using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells were pulsed with 10μM BrdU ...
-
bioRxiv - Neuroscience 2021Quote: Zebra finches received intramuscular (I.M.) injections of 2-Bromo-5’-deoxyuridine (BrdU; Roche Diagnostics) in 0.05 M tris buffered saline (TBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Cell Biology 2024Quote: ... MCs were incubated with 160 µg/ml of BrdU (5-Brom-2′-desoxyuridin; Roche) for 2 h at 37°C and then washed with PBS and fixed with 4% PFA for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI) (Roche, #10236276001, 1:500) with coverslips.
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...