Labshake search
Citations for Roche :
1401 - 1450 of 7615 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... we performed hybridization with 2 μg Cy3-cDNA and the hybridization kit (Roche NimbleGen). The samples were then incubated for 5 min at 65°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were washed 2 times with 1x PBS with protease inhibitor cocktail (Roche, 11836170001). They were lysed on the plate with cold Farnham lysis buffer to ~10×10^6 cells /mL (5mM PIPES pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 infection was confirmed by the RT-PCR-COBAS 6800 System (Roche Molecular Systems ...
-
bioRxiv - Physiology 2020Quote: ... The pellet was then suspended in DMEM containing 2 mg/mL collagenase/dispase (Roche), 0,147 μg/mL TLCK (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM DTT) supplemented with protease inhibitor cocktail (cOmplete Cocktail Tablet, Roche/Sigma Aldrich). The lysate was clarified by centrifugation and passed through a HisTrap HP column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM EDTA and cOmplete ™ EDTA-free Protease Inhibitor Cocktail (Roche product 11836170001) for 30 min on ice ...
-
bioRxiv - Biophysics 2020Quote: ... containing 0.5% (w/v) SDS and 2 μg of proteinase K (Roche, cat. #3115887). DNA fragments were extracted with phenol/chloroform and analyzed by electrophoresis in a non-denaturing 10% polyacrylamide gel ...
-
bioRxiv - Microbiology 2020Quote: ... 10μL of 2× FastStart TaqMan® Probe Master Mix (Roche Life Science, Mannheim, Germany), 750 nM cruzi1 and cruzi2 primers and 250 nM cruzi3 probe (FAM/NFQ-MGB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM β-mercaptoethanol in the presence of EDTA-free protease inhibitor cocktail (Roche) and benzonase (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in the presence of EDTA-free protease inhibitor cocktail (Roche) and benzonase (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2020Quote: ... The LD-PCR mastermix contained 6.25 μl 2× KAPA HiFi HotStart ReadyMix (Roche Diagnostics), 0.125 μl 20 μM PCR_Satija forward primer(30) ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed by adding 10μl 2×HiFi PCR mix (Kapa Biosystems, Cat. 7958927001) and 0.5μl 60mM SINGV6 primer and running the following program ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and blocked for 60 minutes in PBS-T with 2% blocking reagent (Roche, UK), 5% foetal calf serum (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μl of 10 mM dNTPs and 10 units of Transcriptor Reverse Transcriptase (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA pH 8.0 and 0.1% BSA supplemented with protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal ProbeLibrary Assay Design Center (Roche, Supplementary Table 2) and transcript levels of candidate genes were measured by qRT-PCR using the TaqMan hPSC Scorecard™ Panel (384 well ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM MgCl) with with cOmplete Protease Inhibitors Cocktail (PI, Roche Diagnostics, Rotkreuz, Switzerland) and homogenized at 4 °C using a pre-cooled Potter-Elvehjem PTFE pestle at 100 RPM and glass tube with a working volume of 30 mL ...
-
bioRxiv - Microbiology 2023Quote: ... the pellets were sequentially enzymatically treated with 2 mg/ml of Pronase (Roche 165921) in 50 mM of MES (Sigma-M8250 ...
-
bioRxiv - Plant Biology 2023Quote: ... with a KAPA SYBR FAST qPCR Master Mix (2×) Kit (Kapa Biosystems, Wilmington, MA). Relative quantities were determined by the 2(-delta delta Ct ...
-
bioRxiv - Genomics 2023Quote: ... 2 μg of RNA was treated with DNase I for 30 minutes (#04716728001; Roche) and subsequently treated with 1 μl 25 mM EDTA at 70 °C for 10 minutes to inactivate DNase I ...
-
bioRxiv - Cell Biology 2023Quote: ... After physical disaggregation and digestion with 2 mg/ml collagenase B (Roche, CA, USA), the enzymatic activity was stopped by diluting with PBS 1X ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Immunology 2023Quote: Spleens were incubated for 20 min with 2 mg/mL collagenase D (Roche, #11088858001) and then mashed through a 70-μm cell strainer ...
-
bioRxiv - Cell Biology 2023Quote: ... the stripped endothelium–Descemet’s layer was incubated with 2 mg/ml collagenase A (Roche) solution in human endothelial serum free media (SFM ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Biochemistry 2024Quote: ... Next, 50 µl of lytic buffer was added (2% NP-40, protease inhibitors (Roche), 0.2 µM LargeBiT (produced in house ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was treated with 2 mg/mL of pronase from Streptomyces griseus (Roche) in 50 mM Tris-HCl pH 7.0 for 1.5 h at 60°C ...
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). AE1/AE3 (Leica Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Immunology 2024Quote: ... the cells (108/ml) were pretreated with 2 mM Pefabloc SC Plus (Roche #11873601001) for 15 min at 37 °C with rotation set to 10 RPM ...
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.1% SDS,1% NP-40 and 1% Triton X-100) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche) at 4°C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, protease inhibitor cocktail [1 tablet in 50 mL lysis buffer, Roche]). The whole cell extract was denatured ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EGTA and 1 mM dithiothreitol) with 1% protease inhibitor cocktail (04693116001, Roche) and diluted 1x with the 2x loading buffer (65.8 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...