Labshake search
Citations for Roche :
1401 - 1450 of 2968 citations for 5 Bromo 2 3 dihydro 1H indole hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: ... Samples were blocked in MABT containing 5% horse serum and 1% Western Blocking Reagent (Roche). In situ signals were developed as previously reported ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA diluted 1:5 in water was quantified using either SYBR Green I (Roche, # 04707516001) and a LightCycler 480 (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... A 2-step qPCR was done using the LightCycler 480 (Roche, Anderlecht, Belgium). The activation cycle was at 95 °C for 10 minutes ...
-
bioRxiv - Genomics 2019Quote: ... 5.6mmol/L glucose with 2% BSA fraction V fatty acid free (Roche Diagnostics), 50μmol/L 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2019Quote: ... The enzymatic mix was composed by 2 μg/ml collagenase A (Roche 10103586001), 2,4 U/ml dispase II (Roche 04942078001 ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were performed in 1X FastStart Universal Probe Master Mix (Rox) 2× (Roche) in 20 µl volume ...
-
bioRxiv - Bioengineering 2020Quote: ... and 10 μl of 2× KAPA HiFi HotStart Ready Mix (KAPA Biosystems, USA). The following conditions were used ...
-
bioRxiv - Genomics 2021Quote: ... ChIP enrichments were confirmed by qPCR with 2× SYBR FAST mastermix (KAPA Biosystems) using the CFX384 Real-Time System C1000 Touch Thermo Cycler (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM TCEP and an EDTA-free protease inhibitor cocktail tablet (cOmplete, Roche)) and lysed by sonication ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μl of 10 mg/ml of DNase (Roche, catalog no. 10104159001) in an Eppendorf tube ...
-
bioRxiv - Neuroscience 2020Quote: ... Pellet was enzymatically digested in collagenase/liberase TL (2 U/mL) (Roche Diagnostics) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR reaction was performed on a Light Cycler 2 (Roche) using 10 μL SYBR Premix Ex Taq (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol) and supplemented with complete EDTA-free cocktail tablets (Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 0.1 mM TCEP (Tris(2-carboxyethyl)phosphine) supplemented with cOmplete protease inhibitors (Roche). Clarified lysates were passed over 5 ml of packed Ni-NTA agarose resin (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1% 2-Mercaptoethanol) with freshly added protease inhibitor and phosphatase inhibitor cocktail (Roche). Protein equivalent to 10μg was estimated by Bradford assay.
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl of 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, Washington, USA), 1.4 μl of each primer (2.5 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with EDTA-free cOmplete Protease Inhibitor Cocktail tablet (Roche) and immunoprecipitated using C9-agarose bead (Cube biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... SARS-CoV-2 ORFs were amplified by PCR (KAPA HiFi HotStart ReadyMix, Roche) from the 2xStrep-tagged or 3xFLAG-tagged plasmids with oligonucleotide primers containing attB recombination sites and recombined into pDONR221 using BP clonase II (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellet was resuspended in 2 mL Red blood cell lysis buffer (Roche) with 5 µL DNAse (1 mg/mL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM DTT and supplemented with Complete EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2× ReadyMix (Kapa Biosystems) for 21 cycles ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA (2 µg) was treated with 10 units of DNase I (Roche) for 30 min at 37°C and then for 15 min at 70°C ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 μg of total RNA and Transcriptor High Fidelity cDNA Synthesis kit (Roche). Transcript abundance was assayed by semi-quantitative PCR for two gene regions – up-stream and down-stream from the CRISPR-generated insertion (see Supplemental Fig ...
-
bioRxiv - Immunology 2019Quote: ... assays were performed in the presence of 1000 U/mL IL-2 (Roche). Effector-target conjugates were incubated in 200 mL in round-bottom 96-well plates (Corning ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR system (20 μL in total) contained 2×SYBR Green Mix (Roche) 10 μL ...