Labshake search
Citations for Roche :
1401 - 1450 of 1450 citations for 2 Iodomethyl tetrahydrofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 50-200 mL of room temperature Ribosome Lysis Buffer supplemented with 2 EDTA-free protease inhibitor tablets (Roche, Catalog Number 04693132001), Turbo DNAse (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 100-200 mL of room temperature eIF3 Lysis Buffer supplemented with 2 ethylenediamine tetraacetic acid (EDTA)-free protease inhibitor tablets (Roche, Catalog Number 04693132001), 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... To maintain the carryover ≤ 20% with intra-day and inter-day (2 d) CV%≤ 20% acceptable for bioanalytical assays ((Clouser-Roche et al., 2008), it was necessary to perform intermediate a post-run wash injection following each standard and sample injection ...
-
bioRxiv - Microbiology 2024Quote: ... 12 ng of genomic DNA was amplified in a 25 µL reaction comprised of 2x Kapa HiFi Master Mix (Roche cat # KK2601/2), 1 µL of 10 µM V4 515F/806R primers with Illumina adapters (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA -3’ ...
-
bioRxiv - Biophysics 2024Quote: ... Purified motor proteins were diluted to indicated concentrations in the assay buffer with 2 mM of corresponding nucleotides (ATP-Chem Imex, ADP-Sigma Aldrich, or AMPPNP-Roche Diagnostics GmbH)fr ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies to the spike protein receptor binding domain and nucleocapsid were measured by the Roche Elecsys Anti-SARS-CoV-2 S and Anti-N assay (Roche Diagnostics, Indianapolis, IN), per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... eighty nanograms of cDNA products were amplified for another five PCR cycles using KAPA HiFi HotStart Uracil 2 x ReadyMix (Kapa Biosystems, Cat. KK2602) and designed primers Biotin-ACTAG/ideoxyU/CTACACGACGCTCTTCCGATCT and ACTAG/ideoxyU/AAGCAGTGGTATCAACGCAGAG ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed using the extracted DNA (100 ng) as template with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet from a 2 L culture was resuspended in 100 mL lysis buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10 % glycerol, protease inhibitor cocktail (Roche, as directed by the manufacturer), 20 mM imidazole) ...
-
bioRxiv - Plant Biology 2024Quote: ... 15 mM MgCl2, 1 mM EDTA, 10 % glycerol, 1 % Triton X-100, 10 mM β-mercaptoethanol, 2 mM PMSF and Roche cOmplete Protease Inhibitor Cocktail)) were added in the ground leaves and incubated for 30 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µl of 1x Lysis Buffer were added (20 mM Tris-HCl pH8, 150 mM NaCl, 2 mM EDTA, 1x Protease Inhibitor Roche, #04693116001, 1% NP40 Sigma, #I8896), the embryos were smashed by pipetting up and down several times and the samples were centrifuged at 4 °C at maximum speed for 15 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and resuspended in lysis buffer (20 mM Tris-HCl, 1% Triton detergent, 10% glycerol, 2 mM EDTA, 137 mM NaCl, and Roche EDTA-free protease inhibitor, pH 7.4). Cells were homogenized and protein content assessed by Bradford assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... This was followed by a 2-hour incubation in an antibody mixture composed of a 1:1000 dilution of anti-digoxigenin-POD (Roche/Sigma-Aldrich, St. Louis, MO, USA) and a 1:500 dilution of anti-GFP antibody (ab6556 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 µl 10% SDS, 500 µl 20% N-Lauroyl sarsosine sodium, 2 tablets of cOmplete ULTRA Protease Inhibitor Cocktail [Roche Cat.# 05892970001] in 10ml FA buffer). For each IP experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM MgCl2, 1% Triton X-100, 50 mM HEPES pH 7.4, 1 x Protease Inhibitor Cocktail [04693159001, Roche Diagnostics], 50 mM NaF, 0.2 mM Na3VO4). The protein concentration was determined by BCA assay (23225 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 2 mM MgCl2, 1% Triton X-100, 50 mM HEPES pH 7.4, 1 × Protease Inhibitor Cocktail [04693159001, Roche Diagnostics], 50 mM NaF, 0.2 mM Na3VO4). The remaining (87% ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in a protoplast buffer (100 mM Tris-HCl pH 7.5, 2 mM MgCl2, 1M Sucrose, 6 μg/mL of DNAse/ RNAse, 1x protein inhibitor Roche, 800 U mutanolysin, 8 mg/ml lysozyme) and incubated at 30°C for 30 min ...
-
bioRxiv - Immunology 2024Quote: Atherosclerosis was induced in NZW female rabbits by administering Lipofundin 20% through the marginal ear vein at a dose of 2 mL/kg daily for eight consecutive days (Jellinek et al., 1982; Delgado Roche et al., 2012; Medina et al., 2012). To evaluate the antiatherogenic effects of the new R99 mAb variants in vivo ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 150 mM NaCl, 2% w/v PVPP, 10 mM DTT, 1× tablet of cOmplete™, EDTA-free Protease Inhibitor Cocktail [Roche], 0.1% Tween 20 [Sigma] per 50 ml), centrifuged at 4200 × g at 4°C for 20–30 min ...