Labshake search
Citations for Roche :
1351 - 1400 of 3223 citations for Mouse Anti Hepatitis C Virus E1 Antibody 1879 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ZNF274 expression was induced with 1µg/ml doxycycline and verified via western blot with an anti-HA antibody (1:1000, ref.12013819001, Roche) and anti-beta actin antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000).
-
bioRxiv - Genomics 2020Quote: ... Paraffinized at 72°C with EZ solution (Roche Ventana). Antigen for SOX17 was retrieved via CC1 protocol with prediluted Tris solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 sec at 97°C in a LightCycler96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR reactions were run for 50 cycles (95 °C for 15 s and 60 °C for 45 s) on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany). Each sample was examined in three technical replicates and dissociation curves were analysed to verify the specificity of each amplification reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... or 1:500 mouse αFLAG (Roche) and 2° 1:5,000 sheepαmouse (Amersham).
-
bioRxiv - Systems Biology 2021Quote: ... and GFP (mouse monoclonal; Roche Diagnostics). For microscopy ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal GFP (WB, 11814460001; Roche), rabbit polyclonal GluA1 (WB ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP (mouse mAbs, Roche, 11814460001). Antibodies against Aurora A (sheep pAb) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:1,000 mouse αGFP (Roche, 11814460001), 1:500 mouse αPgk1 (Molecular Probes) ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (mouse monoclonal, Roche Molecular Biochemicals), mKate2 (rabbit polyclonal ...
-
bioRxiv - Molecular Biology 2024Quote: ... eGFP (mouse 1:2000, 11814460001, Roche) and Pgk1-HRP (mouse ...
-
bioRxiv - Cell Biology 2020Quote: ... post-nuclear lysates pre-cleared using CL-4B Sepharose beads followed by immunoprecipitation with anti-HA-antibody (12CA5) and Protein G agarose (Roche). Beadbound radiolabelled substrates were resuspended in 2 x Laemmli buffer (+20 mM DTT) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated with blocking buffer (4 % skim milk in 1 × PBS) followed by incubation with the primary antibody: (monoclonal anti-GFP mice 1:5000 (Roche), rabbit anti-GFP 1:10000 ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Maltose binding protein/hemagglutinin-tagged Nuku proteins were detected using an anti-HA peroxidase-conjugated monoclonal rat antibody (3F10; 12013819001 (Roche)).
-
bioRxiv - Evolutionary Biology 2020Quote: ... sections were incubated in a 1:1000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics, Cat. No. 11207733910) then stained with nitro blue tetrazolium (Roche Diagnostics ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Colorimetric whole mount in situ hybridisation (NBT/BCIP) was performed as previously described using anti-DIG antibody conjugated with Alkaline-Phosphatase (Roche) (Schinko et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... The adult inner ears were first were decalcified with 120 mM EDTA for 2 days at 4°C until they were soft and ready for micro-dissecting out the cochlear sensory epithelium for use in whole-amount preparation and immunostaining with the following first antibodies: anti-HA (rat, 1:200, 11867423001, Roche), anti-Prestin (goat ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 2 hr at room temperature with a 1:5000 dilution of alkaline phosphatase-conjugated anti-DIG primary antibody in block solution (Roche, cat #11-082-736-103 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a final probe concentration of 0.1 ng/μL was used and the probe was detected using an alkaline phosphatase conjugated anti-digoxigenin antibody (1:1500; Roche) and NBT/BCIP (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were incubated with 0.5% blocking reagent in PBT before an overnight incubation in 1:2000 anti-dig AP antibody (Roche, 11093274910) in 0.5% blocking reagent (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... 50 μl of the post-nuclear supernatant was saved as the input lysate and 450 μL was incubated with 5μg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted in 1x maleic acid for 1h at RT and riboprobes were detected by incubating in anti-digoxigenin-AP antibody (1:2000 in 1% sheep serum, Roche) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were incubated at room temperature in the following primary antibodies at 1:500 dilution in 1% BSA/1xPBS: rat anti-HA (Roche) and rabbit anti-αTubulin (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... 180 and 365 using Roche Elecsys® Anti-HBs antibody assay on an Elecsys® 2010 analyzer (Roche, Basel, Switzerland). An anti-HBs titer above 10 IU/ml was considered protective (Keating and Noble ...
-
bioRxiv - Microbiology 2021Quote: ... subsequent detection by an anti-DIG antibody conjugated with alkaline phosphatase and activation with the chemiluminescence substrate CDP Star (Roche) were performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Denatured and fully-reduced proteins were resolved on Tris-glycine SDS-PAGE followed by western blot analysis using the following antibodies: rat monoclonal anti-HA (11867423001; Roche), mouse monoclonal anti-V5 (V8012 ...
-
bioRxiv - Cell Biology 2021Quote: ... for 1h at RT and incubated with a primary antibody diluted in blocking solution (sheep anti-digoxigenin, 1/200, Roche) overnight at +4°C in a dark humidified chamber ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were incubated with 1:4,000 diluted peroxidase-conjugated anti-DIG sheep antibody (11-207-733-910; Roche Diagnostics). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... TUNEL staining was performed using ApopTag Red In Situ Apoptosis Detection Kit (S7100, MerckMillipore) combined with peroxidase (POD) coupled anti-DIG antibody (1/200, #11207733910, Roche) followed by tyramide-based amplification61.
-
bioRxiv - Cell Biology 2022Quote: ... Blotting was done as described in (Konrad et al. 2010) using primary rat-derived anti-HA antibody (dilution 1:500, Roche) followed by anti-rat (dilution 1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... slides were incubated overnight at room temperature with anti-DIG antibody conjugated with the alkaline phosphatase (1/5,000, Roche Diagnostics) in B1 containing 1% NGS ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked in TBST with 5% milk protein and probed with the following antibodies: 1:1000 anti-HA (Roche), then 1:1500 goat anti-rat IgG-HRP (Dako) ...
-
bioRxiv - Zoology 2022Quote: ... The DIG-labeled hsd3b probe was visualized by using a horseradish peroxidase-conjugated anti-DIG antibody (Roche Diagnostics, Basel, Switzerland) and TSA Plus Cy3 System (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... Immune complexes were separated with SDS-PAGE and then Western blotted with antibodies against rat anti-HA clone 3F10 (Roche) or rabbit anti-TgSKP1 UOK75 [19]
-
bioRxiv - Synthetic Biology 2019Quote: ... or NF-YC3:FLAG was probed with high affinity anti-HA primary antibodies (Roche, catalog no. 11 867 423 001), anti-MYC (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... for 1 hr and incubated overnight with sheep anti-DIG-POD primary antibody (1:1000, for the DIG-labeled probe; Roche) or mouse anti-biotin (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used for the brain-ring gland complex included a rat anti-HA high-affinity monoclonal antibody (3F10, 1:20 dilution; Roche), a guinea pig anti-Shroud antibody (67 ...
-
bioRxiv - Genomics 2020Quote: ... They were then incubated with TNB (5% FBS in TNT) for 15 min before incubation with peroxidase-conjugated anti-DIG antibody (DIG-POD, Roche) 1:200 in TNB for 2 hr at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then dried and covered in an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:3000; Roche, Mannheim, Germany) in buffer B1/2.5% goat serum at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... a linear DNA tether of the same length was amplified using a digoxigenin-modified primer instead of NTA (5’-DIG-NHS-TCCAAAGGTGAAGAACTGTTCACC, Integrated DNA Technologies, Inc. USA) to bind to anti-digoxigenin Fab fragment antibodies (11214667001, Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Genomics 2020Quote: ... Sections were then washed several times with SSC of increasing stringency and then incubated with alkaline phosphatase-conjugated anti-digoxigenin antibodies (Roche). Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor and tumoroid sections were in-cubated for 40 min with the appropriate antibody before incubation with Discovery UltraMap anti-Rabbit (760–4315, Roche) or anti-mouse horseradish peroxidase (HRP ...