Labshake search
Citations for Roche :
1351 - 1400 of 8057 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Cancer Biology 2023Quote: ... αSMA-tk;RFP mice and C57BL/6 mice received intraperitoneal (i.p.) injections with 12.5 mg/kg of body weight of ganciclovir (GCV, Cymevene®, Roche) every 48h ...
-
bioRxiv - Microbiology 2023Quote: 10-25ml of bacterial cultures were pelleted and resuspended in extraction buffer (50mM Tris-HCl pH 7.5, 5mM EDTA, and 6% SDS) with protease inhibitor cocktail (Roche; 1mg/ml Aprotinin ...
-
bioRxiv - Systems Biology 2023Quote: Glucose concentrations from the chemostat samples were determined enzymatically with a solution of hexokinase/glucose-6-phosphate dehydrogenase (Roche) in Pipes buffer at pH 7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg pAcBAC3 plasmid was used to transfect RAW 264.7 cells by mixing the DNA with 6 μg X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Immunology 2021Quote: The measurement of anti SARS-CoV-2 neutralizing Abs was performed by electrochemiluminescence sandwich immunoassay (ECLIA) through Roche Elecsys Anti-SARS-CoV-2 S (Roche diagnostics, Switzerland). The neutralizing Ab were measured on a Cobas 601 modular analyzer (Roche diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ATP regeneration system (2 mM ATP, 2 mM phosphoenolpyruvate [PEP, Sigma-Aldrich, #P7127], 0.4 mM NADH [Roche, 10107735001], 1.67% (v/v) pyruvate kinase/lactate dehydrogenase mix [PK/LDH ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2022Quote: ... This was followed by a 2-hour incubation in an antibody mixture composed of a 1:1000 dilution of anti-digoxigenin-POD (Roche/Sigma-Aldrich, St. Louis, MO, USA) and a 1:500 dilution of anti-GFP antibody (ab6556 ...
-
bioRxiv - Neuroscience 2023Quote: ... and resuspended in lysis buffer (20 mM Tris-HCl, 1% Triton detergent, 10% glycerol, 2 mM EDTA, 137 mM NaCl, and Roche EDTA-free protease inhibitor, pH 7.4). Cells were homogenized and protein content assessed by Bradford assay ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM EDTA and cOmplete mini-protease inhibitor (Roche)) mixed for 25 minutes at 4 °C to ensure complete lysis ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1x FastStart PCR Buffer including 2 μM MgCl2 (Roche), 0.05 mm dNTPs (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing DNase I (2 U/ml, Roche, Pleasanton, CA) in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 5% FBS (VWR Life Science Seradigm ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were preincubated in 2% blocking reagent (Roche, 11096176001) in MABT (100mM Maleic Acid ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM EDTA) with protease inhibitors (cOmplete Mini, Roche). Lysates were resolved on SDS-PAGE gels (Novex Tris-Glycine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 200 U/ml of IL-2 (Roche) and 50 U/ml of penicillin/streptomycin (Gibco) ...
-
bioRxiv - Zoology 2021Quote: ... 12.5 μl of 2× KAPA HiFi HotStart ReadyMix (Roche), 10 μl of 1μM forward and reverse primers and 2.5 μl of template DNA (5–20 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM MgCl2 with Protease Inhibitor Cocktail (Roche) and clarified by centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM benzamidine and a protease inhibitor cocktail (Roche), and cleared by centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM 2-mercaptoethanol and protease inhibitor cocktail (Roche). The samples were centrifuged at 16,000g for 45 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM 1,10-phenanthroline) containing protease inhibitor (Roche,#4693159001). The homogenates were centrifuged at 100,000 g ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 200 U/ml of IL-2 (Roche) and 50 U/ml of penicillin/streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 100 μl DNase I (2 mg/ml, Roche) in a 37 °C incubator shaking orbitally for 30 min ...