Labshake search
Citations for Roche :
1301 - 1350 of 6757 citations for Streptavidin ZAP Antibody Kit rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... A High Pure Viral RNA Kit (Roche, Switzerland) was used for RNA extraction on all 43 samples ...
-
bioRxiv - Microbiology 2020Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Roche) was used following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Kapa Library Quantification kit (Kapa Biosystems). Barcoded libraries were pooled together in equimolar amounts and each pool was sequenced on HiSeq4000 in SE-50bp mode.
-
bioRxiv - Cancer Biology 2020Quote: ... were prepared with KAPA mRNA HyperPrep kit (Roche). Libraries were sequenced using a paired-end 150bp protocol on a NovaSeq to 50 million reads according to the manufacturer’s protocol (Illumina).
-
bioRxiv - Genomics 2020Quote: ... and using a KAPA Library Quantification kit (Roche). Libraries were pooled and submitted for sequencing on NovaSeq 6000 at the New York Genome Center.
-
bioRxiv - Cancer Biology 2021Quote: ... followed by Chromomap DAB IHC detection kit (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... and the labeling and detection starter kit (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... The “Expend Long Template PCR System” kit (Roche) was used using 300 ng of the 4C library following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Kapa mRNA HyperPrep kit (Roche, Switzerland), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: In Situ Cell Death detection kit (Roche, 12156792910) was used to do Tunel experiment on P21 mouse brains ...
-
bioRxiv - Pathology 2022Quote: ... BrdU (colorimetric) Kit (Roche Applied Science, Indianapolis, IN). Cells were plated on flat bottom 96 well plates (5000 cells per well ...
-
bioRxiv - Genetics 2022Quote: ... the KAPA HyperPrep kit (Roche Cat. No 07962363001) was used with New England Biolabs NEBNext Multiplex Oligos for Illumina (NEB #E7335) ...
-
bioRxiv - Microbiology 2022Quote: ... A diagnostic qPCR (Kapa library quantification kit, Roche) was used to determine the appropriate number of amplification cycles ...
-
bioRxiv - Bioengineering 2022Quote: ... and the KAPA SYBR FAST qPCR kit (Roche) were used to determine the quality and concentration of the finished library ...
-
bioRxiv - Immunology 2022Quote: ... Using KAPA SYBR Fast qPCR Kit (Kapa Biosystems), we amplified cDNA fragments and proceeded with qPCR reactions on CFX96 Thermal Cycler Real Time System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Library preparation utilized a HyperPrep Kit (Kapa Biosystems) and NEXTFLEX DNA Barcodes (Perkin Elmer) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the KAPA HyperPrep kit (Roche Cat. No 07962363001) was used with New England Biolabs NEBNext Multiplex Oligos for Illumina (NEB #E7335) ...
-
bioRxiv - Genomics 2020Quote: ... NimbleGen SeqCap EZ Accessory Kit v2 (Roche: 07145594001), and previously published custom biotinylated DNA oligonucleotides (R1 and HS-38 viewpoints (26) ...
-
bioRxiv - Immunology 2021Quote: ... The depleted RNA was fragmented prior to cDNA synthesis followed by Illumina adaptor ligation using KAPA RNA HyperPrep kit (Roche). The library was analyzed using High Sensitivity DNA ScreenTape 1000 (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... quantified using the KAPA Library Quantification Kit (Roche), and then sequenced on an Illumina MiSeq with 1×125 bp single end reads using a primer that anneals to the 5’ adaptor sequence just prior to the oligo sequence (GCTCGGGGATCCGAATTCTACGCTGAGT).
-
bioRxiv - Cancer Biology 2021Quote: ... with the LightCycler 480 Probes Master Kit (Roche) and Taqman probes (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... were pre-processed with KAPA HyperPlus Kit (Roche) followed by exons enrichment with KAPA HyperCapture Kit (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Smart SYBR Green fast Master kit (Roche Diagnostics) and specific primers (Supplemental Table 3) ...
-
bioRxiv - Plant Biology 2019Quote: ... Using RTS 100 Wheat Germ CECF Kit (Roche), GUN1 protein was expressed in RTS ProteoMaster (Roche) ...
-
bioRxiv - Genomics 2019Quote: ... Library preparation using KAPA mRNA HyperPrep Kit (Roche) was automated using the Hamilton robot ...
-
bioRxiv - Cell Biology 2019Quote: ... using the KAPA SYBR FAST qPCR Kit (Roche) and gene-specific oligonucleotide primers obtained from the Harvard Primer Bank database (Spandidos et al. ...
-
bioRxiv - Pathology 2019Quote: ... BrdU ELISA colorimetric kit was purchased from Roche-Sigma Aldrich (Indianapolis ...
-
bioRxiv - Genetics 2019Quote: ... using a DIG RNA labeling kit (Roche, 11175025910). Probes for wtGH1 and Ghrhr mRNAs were manually hybridized at 0.5 ng/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the KAPA Library Quantification kit (KAPA BIOSYSTEMS). Libraries then were sequenced by Illumina Hiseq 2500 in rapid mode.
-
bioRxiv - Developmental Biology 2021Quote: ... with RiboMap fixation and BlueMap detection kits (Roche) for in situ hybridization ...
-
bioRxiv - Plant Biology 2020Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Roche) was used to reverse transcribe 0.5 μg of extracted RNA into 20 μL of cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... and Lumi-Light Western Blotting Substrate Kit (Roche). FLAG-tagged FLAG-FimV Protein (Rossmann et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the PCR DIG Probe Synthesis kit (Roche). The probe sequences are available in Supplementary Table 2.
-
bioRxiv - Cancer Biology 2019Quote: ... and ChromoMap DAB Kit (760-159, Roche/Ventana) were applied for detection of UBR5 IHC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the KAPA Low Throughput Library Preparation kit (Roche) was used to construct Illumina sequencing libraries according to the manufacturer’s instructions with two exceptions ...
-
Heatrich-BS enables efficient CpG enrichment and highly scalable cell-free DNA methylation profilingbioRxiv - Genomics 2021Quote: ... quantified using Kapa Library quantification kits (Kapa Biosystems) and sequenced using MiSeq v3 150 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... the Roche High Pure PCR template kit (Roche Molecular Systems ...
-
bioRxiv - Genetics 2020Quote: ... or KAPA LTP library preparation kit (Kapa Biosystems). Libraries were multiplexed and sequenced on HiSeq 2500 or NextSeq 500 (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and SeqCap EZ Pure Capture Bead Kit (Roche) following the manufacturer’s instructions for SeqCap EZ Library SR (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Kapa Library Quantification Kit (KAPA Biosystems: KK4824) was used for precise quantification of the library pool ...
-
bioRxiv - Immunology 2020Quote: ... and a KAPA library quantification kit (Roche #7960140001). Samples were sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... and ATP Bioluminescence assay Kit CLS II (Roche) were used to detect relative levels of NAD ...
-
bioRxiv - Cancer Biology 2020Quote: ... the In Situ Cell Death Detection Kit (Roche) was used per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... libraries were prepared using KAPA HyperPlus Kits (Roche). 25 ng DNA was used to prepare the libraries ...
-
bioRxiv - Cell Biology 2021Quote: ... The In Situ Cell Death Detection Kit (Roche Diagnostics Corporation 12156792910 ...
-
bioRxiv - Immunology 2021Quote: ... Kappa SybrFast qPCR kit (Kapa Biosystems, Wilmington, MA) and thermal cycler (CFX96 Real-Time System ...
-
bioRxiv - Neuroscience 2020Quote: ... using the KAPA HiFi PCR kit (Roche Sequencing). IntN and IntC were amplified from the Npu DnaE inteins with site directed mutagenesis according to Lockless and Muir (2009) ...
-
bioRxiv - Cancer Biology 2021Quote: We used SeqCap EZ Custom Enrichment Kit (Roche, Basel ...
-
bioRxiv - Developmental Biology 2022Quote: ... After qPCR quantification (KAPA library quantification Kit, Roche), sequencing were performed on the Illumina NovaSeq 6000 using 2 x 150 cycles to get ∼40 M paired-end reads per sample.
-
bioRxiv - Developmental Biology 2022Quote: ... KAPA Illumina library quantification kit (KAPA Biosystems, MA) was utilized to quantify RNA-seq libraries ...