Labshake search
Citations for Roche :
1301 - 1350 of 2678 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... cDNA (1 μl) was mixed with LightCycler 480 SYBR Green I Master (5 μl, Roche, Basel, Switzerland) and relevant primers (4 μl ...
-
bioRxiv - Genomics 2024Quote: ... The 5’ linker ligated cDNA was then subjected to second strand synthesis with KAPA HiFi mix (Roche) using a second strand primer with an UMI of 25 nucleotides (CTACACTCGTCGGCAGCGTCN25GTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically deglycosylated and eluted from the beads using 5 U of PNGase F (Roche) in 200 µl of 100 mM NH4HCO3 at 37 °C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were then digested by addition of 2 μL 20 mg/mL Proteinase K (Roche) and incubation for 2 h at 55° C ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was removed to 2 ml Eppendorf tubes and incubated with HA antibodies (Roche) for 30 min on a rotator at 4° ...
-
bioRxiv - Microbiology 2020Quote: ... using DK2371 chromosomal DNA as a template and Expand polymerase with Expand buffer 2 (Roche)/ The mutant PCR library was first transformed into PY79 by natural competence ...
-
bioRxiv - Plant Biology 2020Quote: ... 2% Triton X-100 and cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland). Samples were heated at 70 °C for 15 min with 1 x Bolt LDS sample buffer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 10μM stock) and KAPA HiFi hotstart ready mix (2× solution, 12.5μl + 2.5μl H2O, Roche, KK2602). PCR conditions were ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in three volumes of TKE supplemented with 2 mM DTT and PIs (Roche cOmplete). The capsids were sedimented in BSA-coated centrifuge tubes at 110,000 g at 4°C for 20 min (TLA-120.2) ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... 150 mM NaCl) containing 2% Triton X-100 and EDTA-free protease inhibitor cocktail (Roche). The resulting samples were incubated for 1 h at 4°C and spun down twice at 20,800 x g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were cultured in complete media with 30 IU/mL IL-2 (Roche, 202-IL). Media containing IL-2 was replenished daily for 10 days ...
-
bioRxiv - Immunology 2020Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... one of which was treated with 2 U of PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 1 hour ...
-
bioRxiv - Physiology 2022Quote: ... pyruvate supplemented with 2% Bovine Serum Albumin Fraction V Fatty acid free (Roche, USA/UK), 50 µM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... 9ml of cold wash buffer (PBS, BSA 2% and 0.2U/μl RNase inhibitor from Roche) was added and the lysate was dounced with 10 strokes of loose pestle avoiding too much pressure and air bubbles ...
-
bioRxiv - Biochemistry 2021Quote: ... mRNA expression analysis was determined using KAPA SYBR Fast Master Mix (2×) Universal (KAPA Biosystems) in an Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2% Triton X-100 and 274 mM NaCl) containing a cocktail of protease inhibitors (Roche). Cells were lysed for 20 min on ice and centrifuged for 15 min at 17,400 r.p.m ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 2 uL of 50 mM MgSO4 and dNTPs (Roche#11-581-295-001) and thermal cycler program ...
-
bioRxiv - Genetics 2021Quote: ... 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche) was used to resuspend the cells ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and the RNA was subsequently precipitated in 2-propanol and 20 μg/μl glycogen (Roche) overnight at −20 °C ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM PMSF) supplemented with one protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Immunology 2023Quote: Anti-nucleocapsid IgG was measured using the Elecsys Anti-SARS-COV-2 assay (Roche; 09203095190) run on a Cobas e411 analyser (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... the eyes were incubated with 2% Dispase II (neutral protease; Roche Applied Science, Indianapolis, IN) in Hank’s balanced salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Immunology 2024Quote: ... 2 mL aliquots of peripheral blood were treated with 30mL of RBC lysis buffer (Roche) for 5-8 minutes at room temperature with gentle mixing ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 μg/mL DAPI (4,6-diamidino-2-phenylindole, F. Hoffmann-La Roche, Natley, NJ, USA) was added to counterstain the nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM beta-mercaptoethanol) in the presence of a protease inhibitor cocktail (Roche, Basel, Switzerland). These mixtures were incubated on ice for 30 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then digested with Liberase Blendzyme 2 (0.2 mg/ml, Roche Applied Science) and DNase I (20 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated in complete RPMI-10 supplemented with 50U/mL hIL-2 (Roche 11011456001), 2.5ng/mL TGFβ (R&D 240-B-10) ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs were cut roughly and incubated with 2 Wunsch units of LiberaseTM (Sigma/Roche 5401127001) and 1 mg of Pronase (Sigma/Roche 10165921001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Cell Biology 2023Quote: ... 2 ng of cDNA was amplified per reaction in a 364-well plate (4729749001, Roche) with LightCycler® 480 SYBR Green I Master (4887352001 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3h at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... The slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Roche, Switzerland) for 20 min ...
-
bioRxiv - Immunology 2024Quote: ... Cells in each well were co-transfected (Day 2) using X-tremeGENE™ HP (Roche) with 0.8 µg of the appropriate lentiviral transfer plasmid encoding an antigen receptor (1G4 TCR or c259 TCR ...
-
bioRxiv - Microbiology 2024Quote: ... 25 wt% sucrose and 2 mg/mL lysozyme (from egg white, 10837059001 Roche, Basel, Switzerland) and incubated for 30 min at 37 °C ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Roche Diagnostics GmbH, Mannheim, Germany) for 10 minutes to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2 mM activated sodium orthovanadate (Na3VO4) and protease and phosphatase inhibitor cocktails (Roche). Lysates could be stored at -80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 ng of cDNA was added as template to SyberGreen master mix (Roche, Basel, Switzerland) and 250 nM primers (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample were incubated for 2 hours at 37°C before addition of DNAse (Roche, # 04716728001) for 15 min and 0.2M EDTA to stop reactions ...