Labshake search
Citations for Roche :
1301 - 1350 of 2195 citations for 6 Chloro 2 Methoxy 3 Nitropyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The nuclei were stained with 4,6 diamine-2-fenilindole (1 μg/ml, DAPI, Roche). Cells were then washed and mounted with Fluorescent mounting medium (Dako).
-
bioRxiv - Biophysics 2020Quote: ... containing 0.5% (w/v) SDS and 2 μg of proteinase K (Roche, cat. #3115887). DNA fragments were extracted with phenol/chloroform and analyzed by electrophoresis in a non-denaturing 10% polyacrylamide gel ...
-
bioRxiv - Microbiology 2020Quote: ... The anesthetic was 2:1 Ketamine hydrochloride® (Pfizer, Spain):Diazepam ® (Roche, Spain).
-
bioRxiv - Microbiology 2020Quote: ... 10μL of 2× FastStart TaqMan® Probe Master Mix (Roche Life Science, Mannheim, Germany), 750 nM cruzi1 and cruzi2 primers and 250 nM cruzi3 probe (FAM/NFQ-MGB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM β-mercaptoethanol in the presence of EDTA-free protease inhibitor cocktail (Roche) and benzonase (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in the presence of EDTA-free protease inhibitor cocktail (Roche) and benzonase (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2020Quote: ... The LD-PCR mastermix contained 6.25 μl 2× KAPA HiFi HotStart ReadyMix (Roche Diagnostics), 0.125 μl 20 μM PCR_Satija forward primer(30) ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed by adding 10μl 2×HiFi PCR mix (Kapa Biosystems, Cat. 7958927001) and 0.5μl 60mM SINGV6 primer and running the following program ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and blocked for 60 minutes in PBS-T with 2% blocking reagent (Roche, UK), 5% foetal calf serum (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μl of 10 mM dNTPs and 10 units of Transcriptor Reverse Transcriptase (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA pH 8.0 and 0.1% BSA supplemented with protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal ProbeLibrary Assay Design Center (Roche, Supplementary Table 2) and transcript levels of candidate genes were measured by qRT-PCR using the TaqMan hPSC Scorecard™ Panel (384 well ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Biochemistry 2024Quote: ... Next, 50 µl of lytic buffer was added (2% NP-40, protease inhibitors (Roche), 0.2 µM LargeBiT (produced in house ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... the pellets were sequentially enzymatically treated with 2 mg/ml of Pronase (Roche 165921) in 50 mM of MES (Sigma-M8250 ...
-
bioRxiv - Plant Biology 2023Quote: ... with a KAPA SYBR FAST qPCR Master Mix (2×) Kit (Kapa Biosystems, Wilmington, MA). Relative quantities were determined by the 2(-delta delta Ct ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM MgCl) with with cOmplete Protease Inhibitors Cocktail (PI, Roche Diagnostics, Rotkreuz, Switzerland) and homogenized at 4 °C using a pre-cooled Potter-Elvehjem PTFE pestle at 100 RPM and glass tube with a working volume of 30 mL ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were blocked for 2 hours in blocking solution (1% blocking reagent; (Roche, 11096176001) in malic acid buffer (0.15M maleic acid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cell pellets were treated with 1 mL of 2 mg/mL lysozyme (Roche, Switzerland) and incubated at 30 °C for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... After physical disaggregation and digestion with 2 mg/ml collagenase B (Roche, CA, USA), the enzymatic activity was stopped by diluting with PBS 1X ...
-
bioRxiv - Genomics 2023Quote: ... 2 μg of RNA was treated with DNase I for 30 minutes (#04716728001; Roche) and subsequently treated with 1 μl 25 mM EDTA at 70 °C for 10 minutes to inactivate DNase I ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Immunology 2023Quote: Spleens were incubated for 20 min with 2 mg/mL collagenase D (Roche, #11088858001) and then mashed through a 70-μm cell strainer ...
-
bioRxiv - Cell Biology 2023Quote: ... the stripped endothelium–Descemet’s layer was incubated with 2 mg/ml collagenase A (Roche) solution in human endothelial serum free media (SFM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Epidermis was separated from dermis by Dispase 2 (1:100, Roche #04942078001, 20mg/mL), digested in PBS at 37°C for one hour before being peeled off ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was treated with 2 mg/mL of pronase from Streptomyces griseus (Roche) in 50 mM Tris-HCl pH 7.0 for 1.5 h at 60°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The cells were lysed via sonication and lysate was clarified by centrifugation (17,000 rpm for 1 hour at 4°C) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Immunology 2024Quote: ... the cells (108/ml) were pretreated with 2 mM Pefabloc SC Plus (Roche #11873601001) for 15 min at 37 °C with rotation set to 10 RPM ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). AE1/AE3 (Leica Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...