Labshake search
Citations for Roche :
1201 - 1250 of 3087 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 2 μl of 10 mg/ml DNase (Roche, catalog no. 10104159001) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2024Quote: ... Each PCR reaction contained 26.25Lμl 2× KAPA HiFi HotStart master mix (Roche), 2.5Lμl of 10LμM TruSeq RPIX primer (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% sodium dodecyl sulfate (SDS)] supplemented with complete protease inhibitor cocktail (Roche Diagnostics Corp. ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol and 2 protease inhibitor cocktail tablets (cOmplete, EDTA free, Roche)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μL of 2× Sybr Green (LightCycler 96, Roche Molecular Systems, Inc.), 200 nM of each primer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After incubation for 1-2 hours in a 1% blocking solution (Roche) dissolved in 1× PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 mM 2-mercaptoethanol] containing one tablet of protease inhibitor cocktail (Roche), which can inhibit a broad spectrum of serine and cysteine proteases ...
-
bioRxiv - Synthetic Biology 2024Quote: 2 mg of the isolated RNA was digested with DNAse I (Roche) and cDNA was synthesized using the GoScript reverse transcription kit A5001 (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM BME and one tablet of EDTA-free protease inhibitors (Roche)) ...
-
bioRxiv - Systems Biology 2023Quote: ... a total of 121 μL of 2× Kapa HiFi HotStart ReadyMix (Roche), 9.68 μL of PCR_PF (10 μM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM phenylmethylsulfonyl fluoride (PMSF)] supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and PhosSTOP (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and 2 μl of 10 mg/ml DNase (Roche, catalog no. 10104159001). Lymph node tissues were incubated at 37°C for 30 min and filtered through a 70 μm cell strainer ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% glycerol) supplemented with 2 mM Na3VO4 and cOmplete inhibitor mix (Roche), centrifuged (4°C ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Neurons were lysed in 2% Triton X-100 containing protease inhibitors (Roche). A BCA assay (Pierce ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The supernatant was applied to 2 mL of cOmplete Ni2+-agarose (Roche) prewashed with Buffer B (20 mM NaPi ...
-
bioRxiv - Neuroscience 2023Quote: ... The bill-skin was treated with 2 mg/mL collagenase P (Roche) in Krebs solution for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg/ml pepstatin and 100 µg/mL protease inhibitor cocktail (Roche). The lysate was clarified by ultracentrifugation using a TLA-55 rotor (Beckman Coulter ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM L-glutamine (all from Gibco)] supplemented with recombinant human IL-2 (50 U/mL; Roche, cat. 10799068001).
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT) supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche) and 1% Triton X100 ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 2% cOmplete EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland), 10 mM Na4P2O7 ...
-
bioRxiv - Biochemistry 2024Quote: ... the 2 ml Ni-NTA resin (cOmplete His-tag purification resin, Roche) was washed with 10 column volume (CV ...
-
bioRxiv - Pathology 2024Quote: ... 2 % (v/v) FBS and DNase I (40 μg/ml, 10104159001, Roche) in PBS using the gentleMACS Octo Dissociator (Miltenyi Biotec) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 mM EGTA containing 80 uM of cold ATP (10519979001, Roche) was added to each reaction tube ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM MgCl and one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were sonicated in a water bath sonicator at 4°C for 6 minutes to generate a crude lysate ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM EDTA pH 8.0) supplemented with 1x protease inhibitor cocktail (Roche), and incubated for 30 min on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and protease inhibitor cocktail (Roche cat. no. 04693124001) and phosphatase inhibitor (Roche cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... in an IP buffer (1xPBS, 5% glycerol, 0.5 mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 5 mM DTT and a protease inhibitor cocktail (Complete EDTA-free, Roche). Spores were transferred to tubes containing Lysing Matrix E (MP Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% glycerol) supplemented with protease and phosphatase inhibitors (1X EDTA-Free inhibitor cocktail (Roche), 1 mM PMSF ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from lysed cells was removed using 5 μl RNAse-free DNAse I (Roche) for every 1 ml dissociate and incubated at 37°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM EDTA and EDTA-free Protease Inhibitor Cocktail tablets (Roche AG, Basel, Switzerland). Cell debris was removed by centrifugation (4 °C) ...