Labshake search
Citations for Roche :
1201 - 1250 of 1836 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked by incubation in 5% (w/v) milk power or 1 × Western Blocking Reagent (Roche) in Tris-buffered saline and 0.1% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The following primary antibodies were used: GCase (5 µg/mL; hGCase-1/23; mouse monoclonal; Roche [62]); LAMP1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM Tris-HCl, pH 7.5; 5 mM EDTA; 0.5% Igepal-CA630; 1.0% Triton X-100; protease inhibitors [Roche]) and debris was removed by centrifugation ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...
-
bioRxiv - Neuroscience 2023Quote: ... homogenization buffer (0.32 M sucrose, 5 mM HEPES, in PBS pH=7.4, with protease inhibitor cocktail [Roche]) was added to hippocampi samples ...
-
bioRxiv - Immunology 2024Quote: ... intestinal pieces were digested in 5% FBS medium (RPMI) supplemented with 1 mg/ml collagenase D (Roche) and 0.5 mg/ml DNase I (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: Primary antibodies were serially applied using the U DISCOVERY 5-Plex IF procedure (Ventana Medical Systems, Roche). Ready to use DISCOVERY OmniMap anti-Rb HRP (cat ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM Tris–HCl pH 7.4) supplemented with 1% TX-100 and cOmplete protease inhibitor cocktail (Roche) was loaded in reducing and denaturing conditions on NuPAGE (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA (1 μl) was mixed with LightCycler 480 SYBR Green I Master (5 μl, Roche, Basel, Switzerland) and relevant primers (4 μl ...
-
bioRxiv - Genomics 2024Quote: ... The 5’ linker ligated cDNA was then subjected to second strand synthesis with KAPA HiFi mix (Roche) using a second strand primer with an UMI of 25 nucleotides (CTACACTCGTCGGCAGCGTCN25GTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically deglycosylated and eluted from the beads using 5 U of PNGase F (Roche) in 200 µl of 100 mM NH4HCO3 at 37 °C overnight ...
-
bioRxiv - Genomics 2020Quote: ... washed with 500 μL buffer MB#1 (10 mM Tris-HCl, pH 7.5, 50 nM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche complete EDTA-free (Roche diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μl gene specific primer mix (5 μM each) and 4.5 μl FastStart Essential cDNA Green Master (Roche) were amplified using 45 cycles of 25 s at 95 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 ng or less of DNA was used for library preparation using KAPA Hyper Prep Kit (KAPA Biosystems) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fixed embryos were placed into hybridization buffer (50% formamide, 5×SSC, 1 mg/ml yeast tRNA (Roche, 10109223001), 100 μg/ml heparin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM MgCl2, 20 mM Tricine-KOH, 1 mM DTT, 0.15 mM spermine, 0.5 mM spermidine, 1X Roche EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA (5 μg) was used to construct the BS-seq library with the KAPA Library kit (Roche) and EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... Cell pellets were afterwards washed in 5 mM Hepes buffer supplemented with EDTA-free protease inhibitors mix (Roche), resuspended in 0.1M DTT ...
-
bioRxiv - Microbiology 2020Quote: ... with RNA extraction controls—5 μL of LightMix® Modular EAV RNA Extraction Control (EAV; Roche, Basel, Switzerland) or 10 μL of MS2 phage (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... the gDNA fragments were amplified using 5 rounds of PCR with KAPA HiFi 2X master mix (KAPA Biosystems). See Table S4 for primer sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed again in PBS before staining for 20 minutes in DAPI (5 µg/mL, Roche 10236276001) in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% non-fat milk TBST and probed with primary anti-GFP (Roche, 1:1000) and secondary HRP- conjugated anti-mouse antibody (R&D Systems ...
-
bioRxiv - Molecular Biology 2020Quote: Adherent cells were washed twice with PBS and then scraped and digested on ice for 30 min with a homemade RIPA (50 mM Tris-HCl pH 7.5, 15 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS, supplemented with Protease Inhibitors [Roche] and Phosphatase Inhibitors [Sigma-Aldrich]) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.3% (v/v) Tween-20) for 5 min under agitation and next blocked in 1× blocking buffer (Roche) for 30 min at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 mM DTT and 0.5% Triton X-100 (pH 7.5) supplemented with complete protease inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Insect cell lysates containing expressed untagged Cdc28 and Cks1 were prepared as described above in lysis buffer (50 mM HEPES, pH 7.5, 150 mM KCl, 5 % glycerol, 0.01% Tween and complete EDTA-free protease inhibitors [Roche]) and the cleared lysates were used to assemble the trimeric CDC28 complex with 1xStrep-Clb2 purified from E ...