Labshake search
Citations for Roche :
1151 - 1200 of 6676 citations for Oxytocin ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression was quantified in technical triplicates using RT-qPCR performed in 384-well plates on a Roche LightCycler 480 Instrument II with dual hybridisation probes from The Universal ProbeLibrary (Roche). Oligonucleotide sequences used for RT-qPCR are listed in Appendix Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Genomics 2021Quote: ... Early passage cells were seeded at 25% confluency in six-well plates and transfected with 2 ug of expression vector using Fugene reagent (Roche). Cells were harvested and seeded into 100 mm dishes after 48 h of transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed using SYBR green technology in 96 well optical plates with lightcycler 480 real-time PCR machine (Roche) adopting the following thermocycle conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time reverse transcription PCR assays were conducted in 96-well plates using the LightCycler 480 Instrument (Roche, Wilmington, MA). Levels of mRNA expression were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Microbiology 2022Quote: ... Leishmania promastigotes were placed on 96-well flat-bottom plates in the presence of tetrazole salt (XTT) (ROCHE Applied Science) and incubated at 26°C for 4 hours in the dark ...
-
bioRxiv - Cell Biology 2022Quote: ... was used to analyze 4.5 µl of the cDNA dilution in 10 µl reactions on a white LightCycler® 480 Multiwell Plate 384 (Roche). To confirm the absence of PCR contamination ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were extracted by resuspending cells from 6-well plates in 100 μl of RIPA or 7M Urea Buffer containing protease inhibitor (11873580001, Roche) and ...
-
bioRxiv - Genomics 2023Quote: ... The batches of isolated RNA were arranged sequentially in 96-well plates for quality control and preparation of libraries using the standard automated KAPA stranded mRNA library preparation protocol (Roche). One sample was lost in transport before library preparation (HG03478 (MSL)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 100 ng of pCAG-mCherry were transfected into 80% confluent HEK293T cells in 24-well plates using FuGene6 (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: All qPCR reactions were carried out using 384-well plates in 3 technical replicates in 10 µl final reaction volume on the LightCycler 480 System II (Roche). Reaction mix consisted of Power Track SYBR Green Master Mix 2X ...
-
bioRxiv - Cell Biology 2023Quote: Cells from a well of 12-well plate were lysed on ice in 80 µL RIPA buffer (Thermo) supplemented with protease inhibitor cocktail (Roche) and Benzonase (Novagen ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded at 400,000 cells per well in 6-well plates and transfected the day after with indicated cDNA constructs with FuGENE6 (Roche). Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded 72 hours prior to the experiment at 400,000 cells per well in 6-well plates and transfected the next day with wt or mutated myc-ALPK1 constructs with FuGENE6 (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then transferred to a glass depression slide using a glass pasteur pipette and were collected under a dissection microscope and transferred to a well of a 96-well plate filled with 150 μL of BM Purple development solution (Roche). The 96-well plate was kept in the dark for embryo staining to develop ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were harvested from ∼30 mg of tissue (in vivo) or two 6-well plates (in vitro) and homogenised in Ripa buffer with complete mini-proteinase inhibitors (Roche). Preparation of nuclear and cytoplasmic extracts from human fibroblasts was performed using a NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher) ...
-
bioRxiv - Physiology 2023Quote: ... Each RT-qPCR assay was deposited in triplicates on a FrameStar® 384-well skirted qPCR plate (Roche Diagnostics, Switzerland). The qPCR program was initiated at 95°C for 10 minutes to denature the cDNA and activate the TAQ polymerase enzyme in a thermocycler (Lightcycler® 480 II Roche thermocycler ...
-
bioRxiv - Cancer Biology 2023Quote: ... quantitative real-time PCR was performed in duplicates in 384-well plates using Fast Start SYBR Green Master Rox (Roche) on a QuantStudio™ 5 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... were used to inoculate each well of a 96-well plate containing 196 μL of LB media (supplemented with ampicillin, and 200uM IPTG) The plate was covered with transparent LightCycler480 Sealing Foil (Roche), and grown for 24 h in a Biotek Synergy H1 plate reader at 42 °C with double orbital shaking ...
-
bioRxiv - Pathology 2023Quote: ... in HEK 293T cells (3×105 cells per well in 6-well plates) using X-treme gene transfection reagent (Roche). Pseudotyping was achieved by co-transfecting pHEF-VSVg (400 ng/well) ...
-
bioRxiv - Genetics 2024Quote: ... The 5μl total volume reaction was loaded in 384-well plates and was performed in a LightCycler 480 Instrument II (Roche), using a cycling program of ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked by incubation in 5% (w/v) milk power or 1 × Western Blocking Reagent (Roche) in Tris-buffered saline and 0.1% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Cancer Biology 2019Quote: ... PBS was aspirated and 5 ml 0.25% pre-warmed trypsin-EDTA with 10 U/µl DNaseI (Roche) was added and put into a 37°C water bath for 30 minutes with gentle inversion every 5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... the tryptic digests were cleaved by chymotrypsin (5 ng/μl, sequencing grade, Roche, in 25 mM AB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μl of each forward and reverse primer (5 uM) and 10 μl SYBR green (Roche, 4707516001) were used for qPCR (30 sec at 98 °C and 19 cycles of 10 sec at 98 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...