Labshake search
Citations for Roche :
1151 - 1200 of 2394 citations for 6 Chloro 3 imino 2 3 dihydropyridazine 2 acetic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: 800 ng of each fluorescently labelled oligonucleotide probe pool (2 μl; MyTags or Roche Probes) were added to (26 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µL of LC480 SYBR Green I Master (2 X conc. Roche, Product No. 04887352001), 0.1 µL each of forward and reverse primers (20 µM ...
-
bioRxiv - Immunology 2019Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were then digested by addition of 2 μL 20 mg/mL Proteinase K (Roche) and incubation for 2 h at 55° C ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was removed to 2 ml Eppendorf tubes and incubated with HA antibodies (Roche) for 30 min on a rotator at 4° ...
-
bioRxiv - Neuroscience 2019Quote: ... pellets were resuspended in Solution 2 supplemented with EDTA-free protease inhibitor cocktail (Roche Diagnostics), and deacetylase inhibitors (10 mM nicotinamide ...
-
bioRxiv - Microbiology 2020Quote: ... using DK2371 chromosomal DNA as a template and Expand polymerase with Expand buffer 2 (Roche)/ The mutant PCR library was first transformed into PY79 by natural competence ...
-
bioRxiv - Plant Biology 2020Quote: ... 2% Triton X-100 and cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland). Samples were heated at 70 °C for 15 min with 1 x Bolt LDS sample buffer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 10μM stock) and KAPA HiFi hotstart ready mix (2× solution, 12.5μl + 2.5μl H2O, Roche, KK2602). PCR conditions were ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in three volumes of TKE supplemented with 2 mM DTT and PIs (Roche cOmplete). The capsids were sedimented in BSA-coated centrifuge tubes at 110,000 g at 4°C for 20 min (TLA-120.2) ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... 150 mM NaCl) containing 2% Triton X-100 and EDTA-free protease inhibitor cocktail (Roche). The resulting samples were incubated for 1 h at 4°C and spun down twice at 20,800 x g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were cultured in complete media with 30 IU/mL IL-2 (Roche, 202-IL). Media containing IL-2 was replenished daily for 10 days ...
-
bioRxiv - Immunology 2020Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... one of which was treated with 2 U of PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 μL of 10x PCR Reaction Buffer with MgCl2 (Roche Life Science, Indianapolis, IN, USA), 0.15 μL Taq DNA Polymerase (Roche Life Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... NK-92 cultures were supplemented with 150 IU/ml rhIL-2 (Hoffman-La Roche Inc.). The amphotropic-packaging 293T and Phoenix cells were cultured in Dulbecco modified Eagle medium (DMEM) ...