Labshake search
Citations for Roche :
1101 - 1150 of 7005 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cells were lysed in Cell Death Detection Lysis Buffer (Roche, Basel, Switzerland) for analysis of insulin content ...
-
bioRxiv - Zoology 2021Quote: ... quantified by qPCR Kapa Library quantification kit (Roche) and sequenced on an Illumina MiSeq (PE300 ...
-
bioRxiv - Cell Biology 2020Quote: ... Signal was detected using LumiLight Plus Kit (Roche) on the Chemidoc MP imaging system (Biorad).
-
bioRxiv - Genetics 2021Quote: ... and a High Pure Plasmid Isolation Kit (Roche), respectively.
-
bioRxiv - Microbiology 2021Quote: ... quantified using a Kapa qPCR Library Kit (Roche), and sequenced using a MiSeq 500 v2 nano run (MiSeq Reagent Kit v2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the KAPA Library Quantification Kit (Kapa Biosystems). Data from sperm cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... quantified using the KAPA library quantification kit (Roche) and sequenced on an Illumina HiSeq 4000 with 2 × 150 bp paired-end runs.
-
bioRxiv - Immunology 2020Quote: ... KAPA Hyper Prep Kit for Illumina (KAPA Biosystems), and NEXTflex DNA barcodes (Bioo Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... using KAPA SYBR FAST qPCR KIT (Kapa Biosystems). Fold change expression was calculated using the ΔΔct method ...
-
bioRxiv - Molecular Biology 2020Quote: ... and KAPA Library Quantification Kit (Kapa Biosystems, 07960140001). All samples were sequenced on one Illumina HiSeq 2500 lane.
-
bioRxiv - Developmental Biology 2022Quote: ... with RiboMap fixation and BlueMap detection kits (Roche). The amount of probe used (100-300 ng ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using Reverse Transcription Kit (Roche). PCR reactions were performed with FastStart Universal SYBR Green Master (Roche ...
-
bioRxiv - Genomics 2020Quote: ... and the KAPA library quantification kit (Roche, KK4824). Libraries were sequenced on the Illumina Hiseq 4000 ...
-
bioRxiv - Neuroscience 2020Quote: ... TUNEL apoptosis detection kit was purchased from Roche-Sigma (USA) ...
-
bioRxiv - Genomics 2020Quote: ... and Kapa UDI Adapter Kit (Kapa Biosystems KK8727) according to manufacturers protocol with the modifications described below ...
-
bioRxiv - Genomics 2020Quote: ... and quantified by KAPA Library Quantification Kit (Roche).
-
bioRxiv - Immunology 2021Quote: ... and quantified with KAPA library quantification kit (Roche). Barcoded libraries were multiplexed and sequenced on an Illumina HiSeq 2500-RapidRun system on a 50bp single-end mode with a coverage of 20M reads per sample ...
-
bioRxiv - Immunology 2021Quote: ... were quantified using the KAPA Quantification Kit (Roche), and pooled at equimolar concentrations ...
-
bioRxiv - Zoology 2020Quote: ... digoxigenin-UTP (DIG RNA Labeling Kit, Roche Diagnostics), and T7 polymerase (Roche Diagnostics GmbH ...
-
bioRxiv - Immunology 2020Quote: ... KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) and the manufacturer’s suggested cycling protocol was used to complete the PCR reaction with the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... The KAPA Stranded mRNA-seq kit (Kapa Biosystems) was used to create Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... Kapa’s HyperPlus library preparation kit (Roche Sequencing Solutions) was used to prepare sequencing libraries from the double-stranded cDNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... KAPA Real-Time Library Amplification Kit (KAPA Biosystems) was used in conjunction with the library preparation kits described above to minimize the number of PCR cycles for library amplification ...
-
bioRxiv - Microbiology 2021Quote: ... and KAPA HiFi Library Amplification Kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Roche) was used to generate cDNA using a 1:1 mixture of random hexamer and oligodT ...
-
bioRxiv - Neuroscience 2021Quote: ... High Pure RNA Isolation Kit (Roche, Basel, CH) was used to extract total RNA from cell samples using spin columns ...
-
bioRxiv - Genomics 2021Quote: ... or the MagNA Pure DNA isolation kit (Roche Molecular Systems ...
-
bioRxiv - Microbiology 2020Quote: ... A High Pure Viral RNA Kit (Roche, Switzerland) was used for RNA extraction on all 43 samples ...
-
bioRxiv - Microbiology 2020Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Roche) was used following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Kapa Library Quantification kit (Kapa Biosystems). Barcoded libraries were pooled together in equimolar amounts and each pool was sequenced on HiSeq4000 in SE-50bp mode.
-
bioRxiv - Cancer Biology 2020Quote: ... were prepared with KAPA mRNA HyperPrep kit (Roche). Libraries were sequenced using a paired-end 150bp protocol on a NovaSeq to 50 million reads according to the manufacturer’s protocol (Illumina).
-
bioRxiv - Genomics 2020Quote: ... and using a KAPA Library Quantification kit (Roche). Libraries were pooled and submitted for sequencing on NovaSeq 6000 at the New York Genome Center.
-
bioRxiv - Cancer Biology 2021Quote: ... followed by Chromomap DAB IHC detection kit (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... and the labeling and detection starter kit (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... The “Expend Long Template PCR System” kit (Roche) was used using 300 ng of the 4C library following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Kapa mRNA HyperPrep kit (Roche, Switzerland), following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: ... BrdU (colorimetric) Kit (Roche Applied Science, Indianapolis, IN). Cells were plated on flat bottom 96 well plates (5000 cells per well ...
-
bioRxiv - Genetics 2022Quote: ... the KAPA HyperPrep kit (Roche Cat. No 07962363001) was used with New England Biolabs NEBNext Multiplex Oligos for Illumina (NEB #E7335) ...
-
bioRxiv - Microbiology 2022Quote: ... A diagnostic qPCR (Kapa library quantification kit, Roche) was used to determine the appropriate number of amplification cycles ...
-
bioRxiv - Bioengineering 2022Quote: ... and the KAPA SYBR FAST qPCR kit (Roche) were used to determine the quality and concentration of the finished library ...
-
bioRxiv - Immunology 2022Quote: ... Using KAPA SYBR Fast qPCR Kit (Kapa Biosystems), we amplified cDNA fragments and proceeded with qPCR reactions on CFX96 Thermal Cycler Real Time System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Library preparation utilized a HyperPrep Kit (Kapa Biosystems) and NEXTFLEX DNA Barcodes (Perkin Elmer) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the KAPA HyperPrep kit (Roche Cat. No 07962363001) was used with New England Biolabs NEBNext Multiplex Oligos for Illumina (NEB #E7335) ...
-
bioRxiv - Genomics 2020Quote: ... NimbleGen SeqCap EZ Accessory Kit v2 (Roche: 07145594001), and previously published custom biotinylated DNA oligonucleotides (R1 and HS-38 viewpoints (26) ...
-
bioRxiv - Immunology 2021Quote: ... The depleted RNA was fragmented prior to cDNA synthesis followed by Illumina adaptor ligation using KAPA RNA HyperPrep kit (Roche). The library was analyzed using High Sensitivity DNA ScreenTape 1000 (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... quantified using the KAPA Library Quantification Kit (Roche), and then sequenced on an Illumina MiSeq with 1×125 bp single end reads using a primer that anneals to the 5’ adaptor sequence just prior to the oligo sequence (GCTCGGGGATCCGAATTCTACGCTGAGT).
-
bioRxiv - Cancer Biology 2021Quote: ... with the LightCycler 480 Probes Master Kit (Roche) and Taqman probes (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... were pre-processed with KAPA HyperPlus Kit (Roche) followed by exons enrichment with KAPA HyperCapture Kit (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Smart SYBR Green fast Master kit (Roche Diagnostics) and specific primers (Supplemental Table 3) ...
-
bioRxiv - Developmental Biology 2021Quote: ... with RiboMap fixation and BlueMap detection kits (Roche) for in situ hybridization ...