Labshake search
Citations for Roche :
1101 - 1150 of 2697 citations for Mouse Anti Legionella Pneumophila Antibody LN29 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Developmental Biology 2019Quote: ... After a series of washes the probes were detected using FITC conjugated anti-Digoxigenin antibody (1:20, Roche) amplified with anti-sheep Alexa Fluor 488 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1,000 mouse αGFP (Roche) and 2° ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse BrdU (1:50; Roche), rat anti-LAMININ (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... and/or GFP (Roche, mouse) were used at 1:500 and 1:200 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Beads were removed by centrifugation (twice at 1,000 xg) and then pre-cleared lysates were supplemented with anti-HA high affinity monoclonal antibody (clone 3F10, Roche) at 2 µg/ml final concentration along with 20 µl Protein G Sepharose beads and incubated at 4° C for 4 hours on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were boiled 5 min and 50 μg of proteins were separated by electrophoresis on 12.5% SDS-PAGE and subjected to immunoanalysis with either anti-GFP antibody (Roche), anti-Pgk1 antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with an anti-DIG antibody conjugated with horse radish peroxidase (HRP) (1/500, Roche Diagnostics) for 6 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were then blocked for an hour in 5% milk powder/PBS solution and probed with 1:2,500 rat anti-HA mAb 3F10 antibody (Roche) in 5% milk powder/PBS solution overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... ISH detection was performed using anti-DIG secondary antibody conjugated with radish peroxidase (POD) (Roche Diagnostics Corp., Indianapolis, IN) and Opal 570 (1:500 ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... The slides were incubated overnight with a 1:5,000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics). After the slides had been washed in in a solution of 0.1 M Tris (pH 7.5 ...