Labshake search
Citations for Roche :
1101 - 1150 of 1489 citations for DL Lysine 2 15N DiHCl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Cell lysates were prepared in 2× Laemmli loading buffer supplemented with cOmplete protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... femurs were cut roughly and incubated with 2 Wunsch units of Liberase TM and 1mg of Pronase (Sigma/Roche 10165921001) in 2ml Ca2+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... sectioned and stained with various primary antibodies (detailed in Table 2) on an automated system (Ventana Discovery Ultra, Roche, Switzerland). “Intensity” (as specified on Y axes in Figure 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transposed chromatin was amplified using customized Nextera PCR Primer 1 and Primer 2 (barcode) (31) and HotStart KAPA ReadyMix (Roche). Libraries were quantified by Qubit using the DS DNA HS kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were spun (420 RCF x 2 min on LCM-3000 plate centrifuge (Grant Instruments, Royston, UK) before analysis on the Light Cycler 480 (Roche). Samples were run for 50 cycles (10s at 95°C and 30s at 60°C) ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... hippocampi from each animal were homogenized in ice-cold Homogenization buffer (2 M sucrose, 500 mM HEPES (pH 7,4)) containing complete Protease Inhibitor (Roche/Sigma) and spun down for 10 min at 1000 x g at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... qPCRs were performed using specific primers for each gene (Supplementary Table 2) in Roche LightCycler 480 real-time PCR machine using Lightcycler 480 Sybr Green I Master kit (Roche). Actin was used as a reference gene (Supplementary Figure 1) ...
-
bioRxiv - Immunology 2022Quote: ... The cells were washed with PBS and crosslinked for 30 min in 2 ml ice cold 1% formaldehyde containing 2X Complete EDTA-free Protease Inhibitor Cocktail (Roche). Cross-linking was stopped by the addition of glycine to 333 mM ...
-
bioRxiv - Synthetic Biology 2022Quote: Pellets were lysed via sonication of a 33 percent (w/v) cell suspension in 10 mM Tris pH 7.5/2 mM CaCl2 with protease inhibitor (Roche, 11836170001), cleared with centrifugation at 4C ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was performed with 2 x Hieff qPCR SYBR Green Master Mix (Yeasen) and detected by LightCycle 480 Real-Time PCR machine (Roche). For RNA-seq ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... One mL of yeast lysate (1-2 mg/mL) prepared in column buffer freshly supplemented with protease and DUB inhibitors (cOmplete mini EDTA-free (Roche), 10 mM NEM ...
-
bioRxiv - Neuroscience 2020Quote: ... To lyse the cells medium was removed and the well was washed with 2 ml ice cold PBS before 100 µl lysis buffer was applied (RIPA buffer supplemented with PhosSTOP (Roche) and protease inhibitors (cOmplete Mini ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA) supplemented with a cocktail of protease inhibitors (Complete Protease Inhibitor without EDTA, Roche Applied Science, Indianapolis, IN) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... there is a need to stop it after 2 hours by a single injection of diazepam (Valium®, 10 mg×kg−1, i.p.; Roche). Rats were then hydrated with 2 mL of saline solution (0.9% NaCl ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The skin was finely minced with a scalpel and placed for 30 min at 37 °C on a shaker in a digesting enzyme cocktail of 2 mg/ml Collagenase P (Roche), 2 mg/ml Dispase (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... 18 µl cleared cell lysate or brain homogenates (20-100 µg based on Tau aggregate content) were incubated with 2 µl 1 mg / ml pronase (Roche) at 37° C for one hour ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM EGTA) with Halt phosphatase buffer inhibitor (Fisher: PI78420) and Complete mini EDTA-free protease inhibitor (Roche: 4693159001). Samples were sonicated at low power (Qsonica Q55 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Each DNA sample was diluted to 1 ng/μL and 2 μL were used for amplification using PrimeTime Gene expression Master Mix (IDT) with LightCycler96 (Roche) instrument ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH] ...
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...
-
bioRxiv - Genetics 2020Quote: ... Tissues were incubated with primary antibody in dbe+ buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 2 mM EDTA, 1% BSA, 0.05% digitonin with Roche cOmplete protease inhibitor) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: The cell viability of circPSD3 siRNA treated cells was determined at day 2 post-transfection using Cell Proliferation Kit I (MTT, Roche) as previously described [59].
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The cell pellet was then resuspended in 300 μL of homogenization buffer (150 mM KCl, 20 mM HEPES pH 7.4, 2 mM EDTA, cOmplete Mini Protease Inhibitor Cocktail tablet-Roche 04693124001). For the unfractionated sample ...
-
bioRxiv - Cancer Biology 2020Quote: Tumors from MMTV-PyMT mice and C3(1)-Tag mice were resected and minced using a razor blade in DMEM containing 2 mg/mL collagenase and 100 U/mL hyaluronidase (Roche) in a rotator at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pellets were thawed on ice and suspended in 2 mL of lysis buffer A (50 mM NaPO4, pH 7.3, 300 mM NaCl, 2 mM β-mercaptoethanol, 20% glycerol and Roche cOmplete protease inhibitor (1 tablet per 10 mL)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Physiology 2021Quote: ... fish were taken out of their chamber one by one for a 2-min chase protocol (Roche et al., 2013) and returned in their chamber for immediate measurement of to estimate their maximum metabolic rate MMR (Fig ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5X SSC, 100 µg/ml heparin, 100 µg/ml yeast RNA, 0.1% TritonX-100, 0.1% CHAPS, 2% Roche blocking reagent) for more than an hour at 60–65 °C ...