Labshake search
Citations for Roche :
1101 - 1150 of 3395 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Genetics 2022Quote: ... 50 mM Hepes pH 7.6, 2 mM DTT, 0.1 mM PMSF and supplemented with complete protease inhibitor tablets, Roche) were added dropwise and on a vortex with constant low speed to ensure immediate mixing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were collected and washed with ice-cold 1X PBS before being resuspended in Sonication Buffer (20 mM Tris, pH 8.0, 2 mM EDTA, 0.5 mM EGTA, 1X Complete Mini EDTA-free Protease Inhibitor Cocktail [Roche 11836170001] ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... The nucleus was stained with 4,6-Diamidino-2-phenylindole (DAPI, 1 µg/mL in PBS) (Roche; Basel, Switzerland). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysed in lysis buffer (50mM Tris, pH 7.4, 500mM NaCl, 0.4% SDS, 2% Triton-X-100, 1mM DTT, 1x complete protease inhibitor [Roche]). Lysates were sonicated twice for 1 minute at 30% duty cycle at an output level of 4 ...
-
bioRxiv - Biophysics 2022Quote: ... Isolated membrane fractions were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Genomics 2023Quote: ... treated at 55°C and then pre-cleared with 1:2 KAPA Pure beads (Roche Cat. No: 07983298001). The quality and quantity of fragmented DNA were verified using agarose gel (1.5% ...
-
bioRxiv - Genomics 2023Quote: ... Library QC was performed before and after capture in 2 steps: quantification using qPCR (Kapa Biosystems, part #KK4602) and QC using LabChip GX Touch HT Nucleic Acid Analyzer ...
-
bioRxiv - Neuroscience 2024Quote: ... whereas the pellet (insoluble fraction) was resuspended in 2% SDS/TBS supplemented with protease inhibitor cocktail (Roche, Switzerland), 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 300 mM NaCl, 3.0 mM MgCl2, 2 mM DTT, 0.2 % Triton X-100, 1 tablet cOmplete Mini, Roche) and 150 μL MQ ...
-
bioRxiv - Immunology 2024Quote: ... Digestion was performed for 30 min at 37⍰C with 2 mg/ml collagenase D (Roche, Meylan, France), 1 mg/ml dispase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... then Lysis Buffer 2 (10 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1x Roche cOmplete™ ...
-
bioRxiv - Cell Biology 2024Quote: Cultured cells were lysed on ice through repeated pipetting in 2% SDS supplemented with Protease Inhibitor Cocktail (Roche) and PhosStop phosphatase inhibitor (Roche) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Blocking was performed in MAB blocking buffer (100 mM Maleic acid, 150 mM NaCl, 2% Blocking reagent [Roche, 1096176] ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA (2 µl) was added to the mixture with FastStart SYBR Green Master Mix kit (Roche, Basel, Switzerland) and specific primers SP_F 5’-GAC-CAG-TCG-AAC-GCA-CAT-TG-3’ and SP_R 5’-CGG-AGA-GGG-TTG-TTG-TGT-CT-3’ ...
-
bioRxiv - Physiology 2024Quote: ... Glomus cells were dissociated using a mixture of collagenase P (2 mg/ml; Roche Applied Science, Indianapolis, IN), DNase (15 μg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl RNA were incubated for 10 min at room temperature with 0.6 µg baker’s yeast tRNAPhe (Roche), 1 mM MgCl2 and increasing amounts of protein in a volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumor tissue was mechanically dissociated into 2-4mm pieces and then digested in 2.5 mg/mL Liberase and 0.1 mg/mL DNase (Roche) for 1 hour at 37C ...
-
bioRxiv - Developmental Biology 2024Quote: ... were added to freshly prepared DB1 buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5 mM spermidine, 2% glycerol, 1× EDTA-free with Roche complete protease inhibitor ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were lysed with 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM triethanolamine pH 7.4, Roche protease inhibitor, benzonase). Protein concentrations were determined by the BCA assay (Pierce) ...
-
bioRxiv - Genomics 2024Quote: ... for which we could confirm their differential methylation between 4 Col-WT and 4 Col-ddm1 plants by comparing digested and non-digested samples using qPCR (Roche LightCycler 480). We then measured methylation states using this method on DNA extracted using Macherey-Nagel 96-well plate extraction kit (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1.6 μL of 1 M DTT ...
-
bioRxiv - Immunology 2021Quote: We used DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate) (Roche) to introduce LPS or oxPLs into cells following the method by Zanoni et al (Zanoni et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 25 uL of N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM Tris/HCl pH 7.4/50 mM NaF, 10 mM Na4P2O7, 2 mM MgCl2 and Complete Mini, EDTA-free protease inhibitor [Roche]). Lysates were cleared and incubated with GFP-Trap agarose beads for 60 min ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed in Immunoprecipitation buffer (150 mM NaCl, 10 mM Hepes, 2 mM EDTA, 1% Triton, 1.5 mM MgCl2, 10% glycerol, protease inhibitor from Roche) and centrifuged at 14,000 × g ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS and 50 mM DTT with the addition of anti-protease (cOmplete cocktail, Roche 11 873 588 001). Samples were boiled 5 min at 95°C before loading on polyacrylamide gels ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal (3F10) antibody directed against the HA epitope and monoclonal (B-2) antibody against GFP were purchased from Roche and Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 mM EDTA, 15% glycerol, 2 mM MgCl2, 1 mM DTT, 1 mM PMSF, and protease inhibitor cocktail [Roche]). Following clarification by centrifugation ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-μl aliquots of all cDNA samples were analyzed in triplicate on 96-well optical PCR plates (Roche Diagnostics). GAPDH or TBP was used as the reference gene and all analyses were performed using the ΔΔCt method with Roche LightCycler 96 system software ...
-
bioRxiv - Developmental Biology 2021Quote: ... apob-1 and apob-2 levels were detected using the Fast Start Essential Green DNA master mix (Roche 06924204001) on a Roche LightCycler 96 instrument ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocked in 1xBM Blocking/PBST at RT for 2 hours and incubated with anti-DIG-POD (1:1,000, 11207733910, Roche) at 4°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... DRGs from E13.5 embryos were dissected and placed in droplets of 2 mg/ml collagen (Roche Diagnostic, catalog#11179179001) together with COS1 aggregates transfected with either secreted Myc-Sema3A or control PAY1-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA probes were incubated for 2 hours at 37 degrees with Dig RNA labeling mix (11277073910, Roche, Basel, Switzerland) and SP6 or T7 RNA polymerase (RPOLSP6-RO and RPOLT7-RO ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of PCR gene specific primer (10X conc) (Table S1) and 10 μl of master mix (Roche 04707516001) in 20 μl reaction ...
-
bioRxiv - Genomics 2020Quote: ... the pellets were washed with ice-cold nuclei suspension buffer (1X PBS containing 2% BSA and 0.2 U/µl Protector RNase Inhibitor, ROCHE) and filtered through a 30μm cell strainer (Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Cell suspension was then supplemented with 1 mM Tris (2-carboxyethyl) phosphine (TCEP) and 1× complete inhibitor cocktail (Roche). Cells were lysed by sonication on ice and then centrifuged at 80,000 g at 4 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... Lungs were dissected and digested for 30min at 37°C using RPMI media (2% FBS+ Pen/Strep, glutamine, 10mM HEPES) containing 0.5mg/mL Collagenase D (Roche). The digested fragments were passed through a 70μm cell strainer (Greiner bio-one ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subjected to 8 cycles of lysis in a MagNALyser (Roche – 6000 rpm, 1 min on, 2 min off). Lysate was transferred to fresh microfuge tubes and clarified by centrifugation (13,000 rpm ...