Labshake search
Citations for Roche :
1051 - 1100 of 2687 citations for Mouse Anti Clostridium Difficile Toxin A Antibody TA5 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... GFP-Atg8 and free GFP levels were monitored using rat anti-GFP antibody (Roche, Cat. No. 11867423001) and peroxidase-conjugated rabbit anti-rat secondary antibody (Genei ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated with a sheep anti-digoxigenin antibody diluted 1:200 (Roche Diagnostics, Basel, Switzerland) conjugated to the peroxidase enzyme ...
-
bioRxiv - Immunology 2024Quote: ... Primary antibody was detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 520 (NEL871001KT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Primary antibody incubation was carried out overnight at 4°C using anti-DIG-AP solution (Roche 11093274910) in MAB blocking buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... esr2a and esr2b were visualized by incubation with anti-digoxigenin antibody (catalog. no. 11207733910; Roche; RRID: AB_514500) and TSA Plus Cy3 System (TSA-Plus Cyanine 3 system ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were washed and incubated with an anti-DIG antibody coupled to alkaline phosphatase (Roche, 1:3,000). Staining was performed with BM-Purple (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... Specific hybridization was visualized by incubating slides with anti-Digoxigenin-Alkaline phosphatase antibody (1:2000) (#11093274910, Roche) and BM purple AP substrate (#11442074001 ...
-
bioRxiv - Physiology 2023Quote: ... and 1 μL of hemolymph or synthetic HA::spacer::FLAG peptide standard (DYKDDDDKGGGGSYPYDVPDYA) was diluted into 50 μL PBST + 25 ng/mL mouse anti-HA peroxidase (Roche, #12013819001) + 1% non-fat dry milk ...
-
bioRxiv - Pathology 2021Quote: ... Tissue sections were then blocked with blocking solution buffer II (containing 0.1% Triton X-100 and 2% normal sheep serum) at room temperature for 30 min before covering with anti-DIG alkaline phosphatase conjugate anti-digoxigenin antibody (Roche, diluted 1:500 in buffer II) for 1 h at 45°C ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were incubated with the anti-HA high affinity antibody (3F10) (1:500 dilution, Roche – cat. 11867423001), followed by incubation with an anti-rat secondary antibody conjugated to Alexa Fluor 488 (1:2000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with HRP-conjugated rabbit anti-sheep antibodies and detection using ECL reagents (Roche Diagnostic GmbH). A series of timed exposures were undertaken to ensure that densitometric analyses were performed at exposures within the linear range ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated in alkaline phosphatase-conjugated anti-DIG (Digoxygenin) antibody Fab fragments (1:5000; Roche, catalog #12486523) at 1:5000 in the blocking buffer and incubated at 4°C overnight ...
-
bioRxiv - Physiology 2020Quote: ... The sections were incubated with sheep anti-DIG antibody (1:200, Roche Applied Science; cat. no 1333 089), biotinylated donkey anti-sheep antibody (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated with an alkaline phosphatase-conjugated anti-digoxigenin antibody (1:1500 in blocking solution; Roche, Switzerland) overnight at RT ...
-
bioRxiv - Microbiology 2020Quote: ... permeabilized and immunostained with the following primary antibodies - rat monoclonal anti-HA (clone 3F10, Roche: 1:250 dilution), mouse monoclonal anti-myc (clone 9B11 ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were incubated in PEMBALG containing monoclonal anti-HA antibody produced in rat (1:1000 dilution, Roche) for one hour ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Immunology 2024Quote: ... CD3 primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 570 (NEL871001KT ...
-
bioRxiv - Immunology 2024Quote: ... CD11c primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 690 (NEL871001KT ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...