Labshake search
Citations for Roche :
1051 - 1100 of 1222 citations for 6 9 Diphenyl 9H carbazol 3 yl 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... the nucleic acid pellet was resuspended in 38μL of DNase buffer and 2μL of 10U/μL DNase I (Roche, #04716728001), gently mixed ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and then sonicated ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was purified with High Pure Viral Nucleic Acid Kit according to the manufacturer’s instruction (ROCHE, Mannheim, Germany). Viral RNA was amplified by LightMix® Modular Sarbecovirus E-gene (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... diluted 1:150 in washing buffer (45 min) and 4’,6-diamidino-2-phenylindole counterstain (DAPI; Roche/Sigma-Aldrich) diluted 1:250 in TBS (15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Microbiology 2020Quote: Adherent macrophages in 6-well plates were washed with PBS containing 1 mM sodium orthovanadate and 10 mM 1,10-phenanthroline (Roche) on ice prior to lysis ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... the dorsal skin of C57BL/6 neonates was collected and incubated overnight with 1 mg/mL collagenase/dispase (Roche). The dermis and epidermis were separated by incubating the skin with 0.25% trypsin/10 mM EDTA in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Physiology 2021Quote: ... Reactions were performed in a 6 μl volume of 1 x Kapa Probe Fast Mastermix (Kapa Biosystems, Amsterdam, Netherlands). TaqMan assays (FAM labelled ...
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: 10-25ml of bacterial cultures were pelleted and resuspended in extraction buffer (50mM Tris-HCl pH 7.5, 5mM EDTA, and 6% SDS) with protease inhibitor cocktail (Roche; 1mg/ml Aprotinin ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.6; 15 mM NaCl; 10% glycerol; 0.5% Tween 20; 10 mM imidazole; 1 mM DTT; 20 mM NaHCO3; Roche protease inhibitors cocktail without EDTA) ...
-
bioRxiv - Systems Biology 2023Quote: Glucose concentrations from the chemostat samples were determined enzymatically with a solution of hexokinase/glucose-6-phosphate dehydrogenase (Roche) in Pipes buffer at pH 7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg pAcBAC3 plasmid was used to transfect RAW 264.7 cells by mixing the DNA with 6 μg X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μL of 180 mM of adenosine triphosphate (ATP) and 0.5 U of Glucose-6-phosphate dehydrogenase(G6PDH) (Roche). After the absorbance at 340 nm was recorded for 20 min to determine a baseline ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was stored as flow through and the beads were washed 6 times with 1 ml RIPA buffer complemented with 0.25× protease inhibitor (cOmplete, Roche). Bound proteins were eluted from agarose beads with 1 bead volume of Laemmli buffer heated at 95°C for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... αSMA-tk;RFP mice and C57BL/6 mice received intraperitoneal (i.p.) injections with 12.5 mg/kg of body weight of ganciclovir (GCV, Cymevene®, Roche) every 48h ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.7 µM of total delta-Phe aa-tRNA (total tRNA charged with all amino-acids except Phe; tRNA from Roche) and 100 nM of EF-G were used ...
-
bioRxiv - Immunology 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, 1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...