Labshake search
Citations for Roche :
1051 - 1100 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 X protease inhibitor cocktail and 1 X phosphatase inhibitor cocktail from Roche) ...
-
bioRxiv - Immunology 2021Quote: ... and 10% glycerol) containing 1 mM PMSF and 1 × protease inhibitor cocktail (Roche). Then ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EGTA and 1% Triton X-100 with protease/phosphatase inhibitor (Roche) mixture ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mM DTT) with 1 mM PMSF and protease inhibitor cocktail tablets (Roche) by vigorous shaking in a fast prep cell breaker (Bio 101 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Fifty micrograms of total protein were loaded onto SDS-PAGE gels and separated by electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mM EDTA and 1×Complete EDTA free-tablet (Roche Diagnostics, Basel, Switzerland) in distilled water ...
-
bioRxiv - Microbiology 2024Quote: ... Lysozyme 1 mg/ml and 1 tablet of EDTA-free protease inhibitor (ROCHE). Cells were broken passing twice through an Emulsiflex C5 (ATA scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 mM EDTA and supplemented with 1× Complete protease inhibitor cocktail (Roche) by using a Teflon pestle (Schuett Biotec) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM Na3VO4 and 1 mM NaF) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM Na3VO4 and 1 mM NaF) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 30-60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIGprobes were detected with antibodies in MABT containing 5% horse serum appropriate for NBT/BCIP in situ hybridization (Roche anti-DIG-AP 1:1000) or for FISH (Roche anti-DIG-POD 1:1000) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Neuroscience 2024Quote: ... resuspended in 150 μL buffer C (50 mM Tris pH 8, 5 mM EDTA, 1% SDS, 100 mM NaCl, 1x Roche complete mini protease inhibitors) and incubated on ice for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 25mM NaCl, 1 mM EGTA, 1.5 mM MgCl2, 1 mM DTT, 1% Triton TX-100, 10% Glycerol, 1X Roche Complete protease inhibitors) during 1h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor tissues were minced into 1×1 mm fragments and enzymatically dissociated in HBSS containing 1 mg/ml collagenase A (#11088793001; Roche, Basel, Switzerland) and 1 μg/ml DNase I (#07900 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were lysed in 1500 μl ice cold RIPA buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM EDTA, Roche cOmplete and 1 mM PMSF). Cell lysates were clarified by centrifugation (13000 x g at 4°C for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM EDTA) supplemented with 1 mM PMSF and 1 tablet of cOmplete Protease inhibitor (Roche, cat. No. 11 873 580 001) per 50 ml using a MP Biomedical Fast-Prep-24 5G bead beater ...
-
bioRxiv - Neuroscience 2024Quote: ... volume of lysis buffer (25 mM HEPES pH 7.5, 200 mM NaCl, 1 μg ml−1 benzonase, 1 mM PMSF and Roche protease inhibitor tablets). Cells were lysed by dounce homogenization and the NALCN complex was subsequently solubilized by addition of 2% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... volume of lysis buffer (25 mM HEPES pH 7.5, 150 mM NaCl, 1 μg ml−1 benzonase, 1 mM PMSF and Roche protease inhibitor tablets). Cells were lysed by dounce homogenization and the NALCN complex was subsequently solubilized by addition of 2% (w/v ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting pellet was washed four times with buffer II (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 1% triton X-100, 1 mM DTT, 0.1mM PMSF, 1% Roche protease inhibitor cocktail tablet) until the green color was completely removed ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Two mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland,05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Biochemistry 2024Quote: ... was washed once with 80 mL of lysis buffer 1 (20 mM Tris-HCl, pH 8.0) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... with probe prepared by nick translation of a double-stranded PCR product bearing the bcd ORF using alkali-stable digoxigenin-11-2’-deoxyuridine-5’-triphosphate (Roche), visualizing with alkaline-phosphate coupled sheep anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...