Labshake search
Citations for Roche :
1001 - 1050 of 1939 citations for Toll Like Receptor 3 TLR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Plant Biology 2019Quote: ... IP was conducted using the anti-GFP antibody (Roche, 11814460001, Lot: 19958500) and Pierce Protein G magnetic beads (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary antibodies conjugated with HRP and Lumi-Light Western Blotting Substrate (Roche) were used to visualize specific protein bands ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study included mouse monoclonal anti-GFP (Roche Diagnostics), rat anti-HA (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Then sections were incubated with Anti-DIG-AP fab antibody (Roche, 11093274910) prepared in blocking buffer overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The secondary antibody solution was then replaced with DAPI solution (Roche, 10236276) in the dark at room temperature for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary and secondary antibody for FISH were sheep anti-digoxigenin (Roche 11333089001) 1:375 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Hybridized probes were detected using anti-DIG-POD antibody (1:1000, Roche), anti-DNP-HRP antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50mL supernatant and 1mL of anti-HA-HRP antibody (Roche, cat#12013819001) solution (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Hybridization was detected using anti-DIG antibody conjugated with alkaline phosphatase (Roche) and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Microbiology 2021Quote: ... then incubated with biotin-conjugated anti-rat antibody (Roche, diluted 1:8,000) in blocking buffer followed by horseradish peroxidase-conjugated streptavidin (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... All other antibodies were commercially available: mouse αGFP (Roche, 11814 460 001), rabbit αGFP rabbit (life technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by SDS-PAGE and Western Blotting using anti-GFP antibody (Roche), HRP-conjugated anti-mouse secondary antibody (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... Antibody concentrations used were: rat anti-HA high affinity (Roche, Basel, Switzerland) (1:1000) ...
-
bioRxiv - Developmental Biology 2019Quote: ... then incubated overnight at 4°C with anti-DIG antibody (Roche #11093274910) at 1:5000 in block ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoprecipitation was performed using 10 µg of anti-GFP antibody (Roche, 11814460001) (used for Hap2-GFP IP ...
-
bioRxiv - Biochemistry 2019Quote: ... The membrane was analyzed using primary antibodies to GFP (1:1,000; Roche) and anti-porin (1:1,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... Cleared lysates were subjected to immunoprecipitation using anti-GFP antibody (Roche 11814460001) conjugated to protein G magnetic beads (Thermofisher ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used for immunoprecipitation were Protein G Agarose beads (Roche, 1124323301) and anti-FLAG (M2 ...
-
bioRxiv - Neuroscience 2020Quote: ... the fluorescein probe was detected with an anti-fluorescein primary antibody (Roche) and a goat anti-mouse-HRP secondary antibody (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... The probe was detected with an anti-DIG antibody (Roche; 1:10,000) and visualized using CDP-star substrate (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... MRG-1::3XHA was detected with rat anti-HA-HRP antibody (Roche) at a dilution of 1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... The antibodies used for immunoblotting were rat anti-HA (1:3000; Roche), mouse anti-α-tubulin (1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... AP-conjugated-antibody-labeled mRNA was stained using HNPP/Fast Red (Roche). Imaging was performed using an LSM780 confocal microscope (Zeiss) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used: rat anti-HA-HRP (1:1000, Cat. #3F10, Roche), mouse anti-α-Tubulin (1:5000 ...
-
bioRxiv - Plant Biology 2021Quote: ... primary antibodies used are as follows: anti-GFP (1:5000; ROCHE, USA), and custom-made anti-PVX CP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... washed in PBS and incubated with anti-HA-Peroxidase antibody (Roche 12013819001) (1/1000 in PBST + 5 % milk ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected using 1:1,000 anti-HA antibody (Roche) and 1:5,000 anti-rat antibody (Abcam) ...
-
bioRxiv - Plant Biology 2021Quote: ... Signal was developed using anti-digoxygenin-alkaline phosphatase (AP) conjugated antibodies (Roche) and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was visualized using alkaline phosphatase (AP)-conjugated anti-DIG antibody (Roche) followed by chemiluminescence detection.
-
bioRxiv - Developmental Biology 2021Quote: ... and then with POD-conjugated anti-FITC antibody (11426346910; Roche, 1/400) diluted in blocking solution overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were detected using an anti-rabbit HQ detection system (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2021Quote: ... coverslips were incubated with a secondary antibody of anti-digoxigenin fluorescein (Roche) for 1 hour at 37°C and counterstained with 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with alkaline phosphatase conjugated anti-digoxigenin antibody (1:1000, Roche) for 1 h at room temperature ...