Labshake search
Citations for Roche :
1001 - 1050 of 2026 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µl of purified DNA is processed using the KAPA HyperPlus kit (Roche Sequencing, CA, USA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... 0.3% Tween-20 pH 7.5) for 5 min at 37°C and blocking solution (#11585762001, Roche) for 45 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: Protein was harvested in urea ammonium bicarbonate lysis buffer with complete EDTA free protease inhibitor (Roche) and phosphatase inhibitor (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by incubation with 60 µg of Protein A- or G-agarose bead slurry (Roche, Germany) for 4 hours at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested by addition of 40 µl proteinase K (Roche, dissolved to 10 µg/µl) and incubation for 2 hours at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Protein was extracted from cell fractions using RIPA buffer containing protease inhibitor complete EDTA free (Roche) and phosphatase inhibitor cocktail (Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... The FLUC-HA and NLUC-HA proteins were detected with anti HA-HRP antibody (Roche 3F10) (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and hybridized to a mouse monoclonal antibody against the P16 protein (Ventana Roche Diagnostics, E6H4, Switzerland) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... Protein translation was induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG, 11411446001, Roche Diagnostics) and cultures were incubated overnight at 18 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein detection was carried out using peroxidase-coupled anti-HA-Peroxidase antibodies (Roche, dilution 1/4000), peroxidase-coupled anti-GFP antibodies (Milteneyi ...
-
bioRxiv - Physiology 2021Quote: ... triglycerides and total protein were quantified using the Cobas c111 analyzer (Roche diagnostics GmbH, Mannheim Germany) as previously described by Segev-Hadar et al.38 ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein eluted after immobilized metal affinity chromatography (IMAC) using complete His-tag purification resins (Roche) was concentrated using 10KDa cut-off amicon filters (Merck ...
-
bioRxiv - Bioengineering 2021Quote: ... pastoris culture medium containing the recombinant protein was purified by affinity chromatography Ni-NTA agarose (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... cell culture supernatants were harvested and proteins were purified from the supernatants using tandem Ni2+ (Roche) and Strep-Tactin (IBA ...
-
bioRxiv - Molecular Biology 2019Quote: Total protein lysates were prepared using RIPA lysis buffer containing protease inhibitors (Complete Ultra Tablets, Roche). Equal amounts of total lysates were separated by SDS-PAGE (4–15% ...
-
bioRxiv - Cancer Biology 2020Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cell pellets were resuspended in protein buffer containing cOmplete protease inhibitor cocktail (Roche, Basel, Switzerland), lysed by sonication and centrifuged for 45 min at 38,000 g to remove cell debris ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were subsequently detected with HRP-conjugated anti-HA antibody (rat monoclonal, Roche, catalog number 12013819001) or mouse monoclonal anti-GFP antibody (Novus Biologicals ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then Cas9 proteins were digested with 0.5 µl of proteinase K (∼20 mg/ml, Roche) at 37°C for 10 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The protein extraction was performed by adding 10 M urea containing complete protease inhibitor cocktail (Roche) and Halt™ Phosphatase Inhibitor (Thermo ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatants were incubated in presence of 20 µl of protein G agarose beads (Roche, 11243233001) for 3 h at 4°C on a rotor to reduce unspecific binding ...
-
bioRxiv - Biophysics 2020Quote: ... The expressed protein is first purified by affinity chromatography using Ni-NTA coated agarose beads (Roche). His6-tagged proteins are eluted using 250 mM imidazole ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... Cell lysates (1 mg) were pre-cleared with Protein-G–agarose beads (Roche, catalog number 11719416001) for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... The extract was then precleared by incubation with 50 ul of Protein A-agarose beads (Roche) at 4°C for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and homogenized in a T-PER tissue protein extraction reagent supplemented with protease (Roche Applied Science) and phosphatase inhibitors (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 250 mg or 500mg protein was digested with 20 µg/ml proteinase K (PK) (Roche) for PrPSc blots for 1 hour at 37C ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with 30 μl of pre-washed Protein A agarose bead slurry (#11134515001, Roche) for an additional hour (4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... The extract was then precleared by incubation with 50 ul of Protein A-agarose beads (Roche) at 4°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... protein eluates from every purification step were immediately supplemented with protease inhibitors (EDTA-free cOmplete, Roche) (together with DTT at 10 mM for cysteine-containing protein constructs) ...
-
bioRxiv - Cancer Biology 2023Quote: Protein lysates were extracted with ice-cold RIPA buffer supplemented with protease and phosphatase inhibitors (Roche). Thirty μg of protein lysates were separated using SDS–polyacrylamide gel electrophoresis and transferred to a PVDF membrane (Immobilion-P ...
-
bioRxiv - Cancer Biology 2023Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Physiology 2024Quote: Protein cardiac extracts were obtained by tissue homogenization with ceramic beads (MagNa Lyser Green Beads, Roche) in lysis buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein lysates were prepared from zebrafish larvae (6 dpf) in RIPA buffer containing protease inhibitors (Roche), using a manual dounce homogenizer ...
-
bioRxiv - Cell Biology 2023Quote: ... HBE were processed for protein lysates and stored at -20°C (Complete Lysis-M Roche diagnostics). NET dosage was an average of extracellular dsDNA concentration (QuantiFluor ONE dsDNA System ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins with HA-tag(s) were detected using rat mAb-anti-HA 3F10 (Roche, 1:1000) as primary antibody and IRDye® 800CW Goat anti-Rat IgG (Licor ...
-
bioRxiv - Microbiology 2024Quote: ... The recognized protein bands were visualized by 3,3 N-Diaminobenzidine tertrahydrochloride (DAB) solution staining (Roche, Germany).
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...