Labshake search
Citations for Roche :
1001 - 1050 of 6827 citations for 4 1 tert butoxycarbonyl piperidin 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, protease inhibitor cocktail [1 tablet in 50 mL lysis buffer, Roche]). The whole cell extract was denatured ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EGTA and 1 mM dithiothreitol) with 1% protease inhibitor cocktail (04693116001, Roche) and diluted 1x with the 2x loading buffer (65.8 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed twice with Buffer 1 (1× eBioscience Perm/Wash Buffer, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... After homogenizing the tissue in ice-cold PBS with protease inhibitors (1mM PMSF; Phosphatase Inhibitor Cocktail 3, Sigma-Aldrich; Complete, Roche), the extracts were crosslinked with 1% formaldehyde for 10 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... cells at 40% confluency were transfected with 1 µg of mammalian expression plasmid DNA containing gene of interest using 3 µL X-tremeGENE 9 DNA transfection reagent (Roche, 6365809001) diluted in 100 µL 1x OPTI-MEM I reduced serum medium (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... (after a 3-hour fasting period) was measured by taking blood from the tail tip using an Accu-Chek glucometer (Roche Diagnostics). Mice then received an intraperitoneal (ip ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail). Cell lysates were prepared by bead-beating ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl2, 1% Triton X-100, 10% Glycerol, 1 mM DTT, Roche complete protease inhibitor) with 0.5 mg/mL Lysozyme and placed on a roller for 45 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1mM EGTA, 1% Triton X-100, 0.4% SDS, 1% NP-40, 1× Roche protease inhibitor cocktail), one time with wash buffer B (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail) and were lysed by beating with 0.5-mm-diameter glass beads using a FastPrep instrument at a speed of 6.5 m/s for three cycles of 20 seconds each ...
-
bioRxiv - Molecular Biology 2020Quote: Cryosections (10μM) of ventricular tissue were fixed in 4% paraformaldehyde and stained with In-situ Cell Death Detection kit (Roche). Sections were imaged on a laser-scanning confocal microscope (LSM 510 ...
-
bioRxiv - Genetics 2021Quote: ... Then they were incubated overnight at 4°C with primary antibodies diluted in a dilution buffer (0.5% blocking reagent (Roche), 2% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... the embryos were washed and equilibrated in NTMT buffer followed by coloration with 4-nitro blue tetrazolium (NBT, Roche) and 5-Bromo-4chloro-3-indolyl-phosphate ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... qPCR reactions were performed in 10 μl reactions containing 4 μl of LightCycler 480 SYBR Green I Master (Roche), 4 μl of PCR-grade water (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... The PBS was aspirated and 1 ml of homogenization buffer (320 mM sucrose, 4 mM HEPES NaOH, pH 7.4) supplemented with cOmplete EDTA-free protease inhibitor (Roche) and 1 mM ATP NaOH ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Genomics 2021Quote: ... These cells were re-suspended in lysis buffer (4% SDS, 50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 mM NaCl) with Protease inhibitor (Roche) and RNase inhibitor ...