Labshake search
Citations for Roche :
951 - 1000 of 7615 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with 2% NBT/BCIP solution (Roche) in the developing buffer at room temperature in the dark ...
-
bioRxiv - Cancer Biology 2021Quote: ... which contained 2 mg/ml collagenase A (Roche Applied Science), for 1 hr at 37°C shaking at 120 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche). Protein concentration was quantified using the BCA protein assay kit (Pierce) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2% w/v SDS) supplemented with protease inhibitor cocktail (Roche) and phosSTOP (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Labyrinth and decidua samples were digested with 2% DNAseI (ROCHE)/Liberase (Liberase™ TM Research Grade ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 mM EDTA) supplemented with protease inhibitor cocktails (Roche), and sonicated for 10 s ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were subsequently treated with 2% blocking reagent (Roche Diagnostics) in maleic acid buffer with Tween-20 (MABT) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS) containing 2 μg/mL protease inhibitors (Roche, Germany). The supernatants of cell lysates were collected before their protein concentrations were determined using a BCA protein assay kit (Pierce Biotechnology ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2?mM EDTA) supplemented with protease inhibitor cocktail (Roche Diagnostics) and cleared by centrifugation at 12,000x?g at 4?°C for 10?min ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 2% NP-40) with the addition of protease inhibitor (Roche cOmplete mini-pellet ...
-
bioRxiv - Physiology 2020Quote: ... Skin was incubated in 2 mg/ml Collagenase P (Roche) in Krebs solution (in mM ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT and EDTA-free protease inhibitor tablets (Roche). Sonicate supernatants were loaded onto GST-4B resin (Amersham ...
-
bioRxiv - Genetics 2021Quote: ... 2 mM EDTA) supplemented with a protease inhibitor cocktail (Roche) and 1 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 mM EDTA) supplemented with protease inhibitor cocktails (Roche), and sonicated for 10 s ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg/ml RNase A and protease inhibitor mixture (Roche). Proteins were bound to Ni-NTA resin (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Pefabloc and protease inhibitor (Mini Complete, Roche, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM PMSF and protease inhibitors (Roche Diagnostics, Mannheim, Germany)) by disruption with glass beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA (2 μg) was mixed with oligo-dT (Roche) and dNTP (Yeastern ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM MgCl2 and EDTA-free protease inhibitor cocktail (Roche)) and lysed in an ice-cold sonicating water bath for 5 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... the sections were pre-blocked with 2% blocking reagent (Roche)/20% FBS/TBST at 25ºC for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were blocked in 2% DIG blocking reagent (Roche, 11096176001) in MABT for two hours at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... SDS 0.1% with protease (2%) and phosphatase (10%) inhibitors (Roche)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM PMSF) supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and PhosSTOP (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking was performed in 1xMABT with 2% Blocking Reagents (Roche) and 10% donkey serum (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Physiology 2024Quote: ... 2 × KAPA SYBR FAST qPCR Master Mix Universal (KAPA Biosystems), 5 μl of sample solution ...
-
bioRxiv - Genomics 2023Quote: ... 2 mM MgSO4 and protease inhibitor cocktail (Roche cat# 04693132001)) was added and bacteria was incubated on ice for 15 min before centrifugation for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... they were blocked with 2% bovine serum albumin (BSA, Roche). Samples were incubated overnight at 4°C in the same blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche) and lysates were sonicated followed by quantification using the Pierce BCA protein assay (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 tablets of cOmplete EDTA-free protease inhibitor cocktail (Roche), 0.1 mg/ml lysozyme ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml of the cOmplete His-Tag purification resin (Roche) equilibrated with the Tris buffer 4 containing 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Plant Biology 2024Quote: NATA1Δ and NATA2Δ were preincubated with 2 mM acCoA (Roche) and 5 mM of ligands (purchased from Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was conducted by adding 2× HotStart Readymix (Kapa Biosystems), 5′-end biotin-modified P7 primer (10 μM) ...
-
bioRxiv - Cell Biology 2024Quote: ... and then to MABT with 2% blocking reagent (Roche, 11096176001) at 4°C overnight ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...