Labshake search
Citations for Roche :
951 - 1000 of 8293 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH] ...
-
bioRxiv - Cancer Biology 2019Quote: ... PDX tumors were minced with No.22 blades into 1-2 mm fragments then digested with 1mg/ml collagenase/dispase (Roche) for 30-40 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... one organoid per condition was lysed with Urea Buffer (7M Urea, 2M Thiourea, 2% CHAPS, 1% DTT (w/v) and Complete protease inhibitor cocktail (Roche) in MilliQ water) ...
-
bioRxiv - Immunology 2019Quote: ... memory B cells were plated at 6 B cells in 55 μl per well into 96 × 384-well plates in B cell media supplemented with 100 U ml−1 IL-2 (Roche), 50 ng ml−1 IL-21 (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... Tissues were incubated with primary antibody in dbe+ buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 2 mM EDTA, 1% BSA, 0.05% digitonin with Roche cOmplete protease inhibitor) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... the trachea was catheterized and BAL was performed by 2 consecutive flushes of the lungs with 1 mL ice-cold PBS containing Complete Protease Inhibitor Cocktail (Roche). Cell density in BAL fluid (BALF ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed once with PBS and resuspended in ice-cold WCE buffer (10 mM Tris-HCl, 1% NP-40, 2 mM MgCl2, benzonase, cOmplete Protease Inhibitor Cocktail (Roche), 25 nM NEM where relevant ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed twice in cold 1× PBS and harvested in 2% SDS in 50 mM HEPES buffer with freshly added protease and phosphatase inhibitors (Roche). Cell lysates were sonicated and centrifuged for 15 min at 12000 ×g to remove the insoluble fraction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA, 0.1% NP-40, 1 mM DTT, 10 mM NaF, and EDTA-free protease inhibitor cocktail, Roche, Germany), and centrifugation at 20,000 × g for 3 min ...
-
bioRxiv - Cancer Biology 2022Quote: A total of 20-50 mg of snap-frozen melanoma tissues were pulverized by Geno/Grinder for 2 min at 1500 rpm and then fixed with 1% methanol-free formaldehyde plus protease inhibitor cocktails (Roche) for 10 min at room temperature and quenched by 125 μM glycine for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated in an anti-digoxigenin antibody (alkaline-phosphatase-coupled anti-digoxigenin; RRID:AB_514497, diluted 1:3,500; Roche Diagnostics; Table 2) for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Thawed cells were resuspended in solubilization buffer (20 mM HEPES pH 8, 500 mM NaCl, 2 mM MgCl2, 15% glycerol, 1 Roche EDTA free Protease inhibitor tablet ...
-
bioRxiv - Neuroscience 2023Quote: Mouse brains at 5W were isolated and homogenized in homogenization buffer [(0.32 M sucrose, 10 mM HEPES, 2 mM EDTA and 1× complete protease inhibitor cocktail (Roche Diagnostics), pH 7.4)] ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were incubated for 1 hour in TBST and then in Blocking Buffer (2% blocking reagent in maleic acid buffer pH 7.5 (Roche, #11096176001) and 10% sheep serum (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were incubated at 4°C overnight with the primary antibody mouse IgG1 Anti-Tbx6 (home-made, clone A83, dilution 1:500) in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissue was sonicated in homogenization buffer (1% SDS, 50 mM Tris pH 7.4, 2 mM EDTA, protease and phosphatase inhibitors (Roche 11873580001; Roche 04906837001), heated at 95° C for 5 minutes ...
-
bioRxiv - Immunology 2023Quote: ... minced with scissors and razor blade in the presence of 1 ml of digest media (2 mg/ml collagenase IV (Roche), 1 mg/ml hyaluronidase (Worthington) ...
-
bioRxiv - Microbiology 2024Quote: ... and lysed by incubation with nondenaturing lysis buffer (300 mM NaCl, 100 mM Tris-HCl [pH 7.4], 2% Triton X-100, and 1×EDTA-free protease inhibitor cocktail [Roche Complete]) for 30 min on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... colorimetric reaction was performed for 1-2 days at room temperature in a solution containing NBT (nitro-blue tetrazolium chloride, Roche) and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and 1% Triton X-100) containing 2 mM Na3VO4 (Sodium Orthovanadate) and 1 mM pmsf (phenylmethylsulfonyl fluoride) and 1x protease inhibitor cocktail tablet (Roche). Whole cell lysates were centrifuged at 12,000 rpm at 4 0C for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% BSA (Roche), 20% Dextran Sulfate (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Cell Biology 2019Quote: ... 1× PhosSTOP (Roche)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× cOmplete (Roche), and lysed by bead-beating ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP40 (Roche) and a phosphatase inhibitor mixture containing 20 mM NaF ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/1000 (Roche); HRP-conjugated anti-FLAG antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... PhosSTOP 1% (Roche)) and mechanically with a pellet pestle ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2021Quote: ... mitotic cells were obtained by mitotic shake-off and swelled in hypotonic buffer (75 mM KCl:0.8% NaCitrate:H2O at 1:1:1) with protease inhibitor cocktail (Roche) at room temperature for 10-15 min ...
-
bioRxiv - Microbiology 2020Quote: Whole cell lysates were generated by lysing cells in RIPA buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1× Roche complete mini-protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6.8, 10 mM DTT, 1 mM EDTA, 0.1% Tween, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche). The samples were centrifuged at 3000g for 6 min at 4°C using a tabletop centrifuge ...
-
bioRxiv - Genomics 2024Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Sodium Deoxycholate, 0.1% SDS, 1× Protease Inhibitor cocktail, Roche) and incubated at 4 °C for 1 hour with rotation ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...