Labshake search
Citations for Roche :
951 - 1000 of 7503 citations for 6 Hydroxy 1 2 benzisothiazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded in 10 cm tissue-culture treated dishes and transfected with FuGENE 6® reagent (Roche) for 24 hr ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... hDAT and Stx1 constructs were transiently cotransfected into these cells (hDAT cells) using Fugene-6 (Roche Molecular Biochemicals) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The mini-genes in the pSPL3b vector were transiently transfected using 6µl of FuGENE 6 Transfection Reagent (Roche) with 2 µg of vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five pupae were homogenized in 100uL of homogenization buffer (125 mM Tris pH 6.8, 6% SDS, 2.5X Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2023Quote: ... Vectors were co-transfected with packaging-defective helper plasmids into 293T cells using Fugene 6 transfection reagent (Roche). Fibroblasts were plated at a density of 50,000 cells/well on 0.1% gelatin-coated 6-well plates and infected three times with a viral cocktail containing vectors expressing OCT4:SOX2:KLF4:cMYC in a 2:1:1:1 ratio in the presence of 6 µg/ml protamine sulfate (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Both were fragmented at 94°C for 6 min and ligated with KAPA Unique Dual-Indexed adaptors (Roche). Library quality was checked on an AATI (now Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... an additional 6-cycle PCR was carried out with the HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and primers that preserve the DNA sequence ...
-
bioRxiv - Biochemistry 2021Quote: ... 2×106 cells HEK293T cells were transfected with 2 μg plasmid DNA using X-tremeGENE HP DNA Transfection Reagent (Roche) in 10-cm dishes ...
-
bioRxiv - Immunology 2023Quote: ... dissociated from the coverslips in 8 M urea lysis buffer (100 mM NaCl, 25 mM Tris, 2% SDS, 0.1% tween 20, 2 mM EDTA, 0.2 mM PMSF, and 1x Roche cOmpleteProtease inhibitor). Lysates were treated with benzonase (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... The parasites were pelleted by centrifugation at 25,000 x g and resuspended in 5 × the pellet volume with hypotonic lysis buffer (1 mM HEPES-NaOH pH 7.4, 2 mM EGTA, 2 mM DTT with protease inhibitor cocktail; cOmplete™, EDTA-free, Roche). The parasite suspension was incubated for 10 min on ice and then lysed by approximately 30 passages through a 1mL syringe fitted with a 27G needle.
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM EDTA with 1x protease inhibitors (Roche). Protein concentrations were quantified with a BCA Kit (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... For cDNA synthesis 2 μg of DNaseI (Roche) treated total RNA was reverse transcribed using M-MuLV reverse transcriptase (Minotech) ...
-
bioRxiv - Genetics 2019Quote: ... 2 mM benzamidine and protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x KAPA HiFi buffer (Kapa Biosystems), 0.3 µl 10 mM dNTPs (Kapa Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM Na3VO4 and protease inhibitor cocktail (Roche), 1 tablet per 10 ml) ...
-
bioRxiv - Immunology 2019Quote: ... 100U/mL IL-2 (Roche Diagnostics or Biolegend) was used throughout ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM PMSF) supplemented with cOmplete™ (Roche) protease inhibitors ...
-
bioRxiv - Genomics 2019Quote: We used DAPI “40,6-diamidino-2-phenylindole” (Roche) with “SlowFade” antifade reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl biotin-16-dUTP (Roche 11093070910), and were incubated at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... and/or DAPI (Roche: 10236276001, 2 μg/mL) before mounting to visualize barrel map ...
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 100 U/mL Il-2 (Roche). K562 cells were obtained from ATCC (CCL-243 ...
-
bioRxiv - Neuroscience 2019Quote: ... 10X expand long template buffer 2 (Roche, 11681842001), expand long template enzyme mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 2 mg/ml Collagenase A (#10103586001, Roche), 2.4 U/ml Dispase II (#04942078001 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μg/mL DNAse (11284932001, Roche Diagnostics), and incubated for at least 10 min on ice before sonication (10 cycles of 15 s with 30 s cooling at 8 microns amplitude ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2% BSA fraction V (Roche Diagnostics, Mannheim, Germany), 10 mM nicotinamide (Merck Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM benzamidin and protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mg/ml protease inhibitor cocktail (cOmplete, Roche)] on ice for 30 minutes ...