Labshake search
Citations for Roche :
951 - 1000 of 1331 citations for 6 Bromo benzo d isoxazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...
-
bioRxiv - Immunology 2022Quote: Excised tumors were cut into small pieces following by incubation 0.5 mg/ml collagenase D (Hoffmann-La Roche, Basel, Switzerland), 10 µg/ml DNAse I (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Spleen from C57BL/6J mice were mechanically disrupted using the back-end of a syringe before addition of 50 μL 11x concentrated collagenase D (Roche, #11088866001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... dissociated with an equal mixture of 4 mg/ml of collagenase D and dispase II (Roche Applied Science, Indianapolis, IN) and cultured in F-12K (Corning ...
-
bioRxiv - Microbiology 2022Quote: Lungs were perfused with sterile PBS and digested at 37°C for 1 h with 625 μg/mL collagenase D (Roche) and 75 U/mL DNase I (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... in a plate and mechanically disrupted using the back-end of a syringe before addition of 50 μL of a digestion media (dRPMI = naRPMI supplemented with 11x collagenase D (#11088866001, Roche, Woerden ...
-
bioRxiv - Immunology 2023Quote: ... Kidneys were homogenized using the Miltenyi gentleMACS Dissociator and digested for 20 minutes at 37°C in RPMI with 2 mg/mL collagenase D (Roche) and 0.1 mg/mL DNAse I ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Immunology 2023Quote: Spleens were injected with HBSS (with Ca2+ and Mg2+) containing 1 mg/mL of collagenase D and 10 μg/mL of DNase I (Roche) and incubated for 20 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 mL dissociation buffer (RPMI-1640 (Cytiva) with 25 mM HEPES and 10 µg/mL gentamicin sulfate) supplemented with 2 mg/mL Collagenase-D (Roche) and 100 U DNaseI (Roche) ...
-
bioRxiv - Immunology 2023Quote: Lungs were perfused with sterile PBS and the left lobes of the lungs were digested at 37°C with 630 µg/ml collagenase D (Roche) and 75 U/ml DNase I (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... lung and liver tissues were mechanically disrupted into small pieces and enzymatically digested in 2ml of digestion buffer (1 mg Collagenase D (Roche) and 0.2 mg DNase I (Roche ...
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The aqueous liquid phase containing the nucleic acids was removed and added to the columns of the High Pure RNA tissue kit (Roche Diagnostics, UK). RNA was purified using repeated wash steps and DNAse treatment ...
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids from these 200μL mosquito pools and from 100μL venous and finger prick whole blood samples in RNAprotect Cell Reagent were isolated using the bead-based MagNAPure LC automatic extractor (Total Nucleic Acid Isolation Kit—High Performance, Roche Applied Science) and eluted in 50μL of water ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were then washed with 0.1% PBST and incubated in 1% blocking buffer (1% blocking reagent [Roche, 11175041910] in Maleic acid) for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from the lysate using the Roche MagNA Pure Compact Nucleic Acid Isolation Kit I and the MagNA Pure Compact instrument (Roche, Indianapolis, Indiana). Dual-indexed sequencing libraries were prepared from the lysates using Nextera XT DNA Library Preparation Kit (Illumina FC-131-1096) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were transferred to a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume kit (Roche, Mannheim, Germany) and centrifuged for 8 min with 1,500 rpm at room temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 140 mM NaCl, 1mM ethylenediaminetetraacetic acid, 1% Triton X-100, 0.1% Na-Deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 200 µL Roche cOmplete protease inhibitors). 0.5 mm diameter glass beads were added to 1 mm below the meniscus ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System, Laval, QC, Canada) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA levels were determined using gene-specific primers by SYBR green nucleic acid labeling (Selleckchem PCR Mastermix, #B21202) in a Lightcycler 480 (Roche, Indianapolis, IN). Fold change was calculated using the delta delta C(t ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Resulting cell pellets were resuspended in Buffer A (100 mM NaH2PO4, 10 mM Tris, 6 M GuHCl, 10 mM imidazole) + PIC (Roche 05056489001). Cells were sonicated 3X at 25% power for 10s (Cole-Parmer GE 130PB-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were added and after an additional 6 hours BrdU was added and a cell proliferation assay was performed according to the manufacturer’s instructions (Roche Applied Sciences).
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: Mice were fasted for 6 h and baseline blood glucose levels were measured with an Accu-Check Performa blood glucose meter (Roche, USA) using blood collected from the tail vein ...
-
bioRxiv - Immunology 2019Quote: ... Each reaction consisted of a total amount of 12 µL divided into 6 µL LightCycler 480 SYBR Green I Master (Roche Diagnostics), 2 µL primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments were separated on 0.7% agarose gels buffered with 40 mM Tris-acetate at 4V/cm for 6 h and transferred overnight to nylon membranes (Roche, Switzerland) by alkaline transfer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 μl of the lysis buffer was added to each 6-well plate along with 1×Protease Inhibitor Cocktail (PIC, Roche cOmplete). The cells were incubated in a rocker at 4°C for 1hr ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...