Labshake search
Citations for Roche :
51 - 100 of 499 citations for Siglec 9 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or pRetroX-Tet-On using X-tremeGENE 9 (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected using X-TremeGENE 9 (Roche) with the pLentiCRISPR plasmids and the lentiviral packaging plasmids pMD2.G and psPAX2 to generate lentiviral particles coated with the VSV-G protein and incubated overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 μL X-tremeGENE 9 DNA transfection reagent (Roche) and 500 μL Opti-MEM media (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was generated by using Xtremegene-9 (Roche 06365787001) to co-transfect the scaffold-containing pLenti plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 uL X-tremegene-9 transfection reagent (Roche 06365787001), 0.3 μg pCMV-VSV-G (Addgene Plasmid #8454) ...
-
bioRxiv - Biophysics 2020Quote: ... and amplified using KAPA Hi Fi polymerase (Roche) in 20 cycles of emulsion PCR35 (ePCR ...
-
bioRxiv - Biochemistry 2022Quote: ... purified by cOmplete His-Tag purification columns (Roche), and concentrated to 1 mg/mL using Amicon Ultra 10,000 NMWL (Merck) ...
-
bioRxiv - Microbiology 2020Quote: ... and cOmplete™ His-tag Purification Resin (Roche). Purity and glycosylation of recombinant proteins were examined by PNGase F (N-Zyme Scientifics ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cOmplete his-tag purification matrix from Roche is working equally well ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... Complete His-Tag Purification Resin (Roche, Basel, Switzerland), or Amylose Resin (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... or X-Treme transgene 9 transfection reagent (Roche, Basel, Switzerland), according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected using X-tremeGENE 9 transfection reagent (Roche). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell line using X-tremeGENE 9 DNA transfection reagent (Roche). 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using X-tremeGENE 9 DNA transfection reagent (Roche, cat# 6365779001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded and transfected using XtrememGene 9 (Roche, USA) according to manufacturer’s manual 48 h prior to infection ...
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12.5 μL of Kappa Hi Fi Hotstart ReadyMix (Roche) and each 0.75 μL (0.3 μM ...
-
bioRxiv - Biochemistry 2020Quote: ... and incubated with cOmplete His-Tag purification resin (Roche) for 16 hours on a tube roller (Starlab ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12.5 μL of Kappa Hi Fi Hotstart ReadyMix (Roche) and each 0.75 μL (0.3 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... 12 µl of complete His-Tag Purification Resin (Roche) was added and incubated for 15 min at 25°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we used Kapa Hi-Fidelity Library Amplification Kits (Roche) in 20 µL reactions with 4µL Nextera Unique Dual Indexes Set A (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... or Complete His-Tag Purification Resin (Roche, Basel, Switzerland), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid constructs were transfected into HEK293 cells by using X-tremeGENE HP (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were transiently transfected with C5aR2-Venus and βarr2-Rluc8 constructs using XTG9 (Roche). 24 hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: Clarified supernatants were rocked with Complete His-Tag resin (Roche), 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were loaded onto His-tag purification column (Roche) and the protein was eluted in a buffer containing 20 mM HEPES ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated with 4mL cOmplete His-Tag Purification Resin (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml of the cOmplete His-Tag purification resin (Roche) equilibrated with the Tris buffer 4 containing 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and purified using cOmplete His-Tag Purification Resin (Roche, Switzerland) and His-Bind Purification kit (Novagen ...