Labshake search
Citations for Roche :
51 - 100 of 1668 citations for Recombinant Mouse Erbb2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... and recombinant proteinase K (Roche). Samples were run on a 1% certified megabase agarose (Bio-Rad ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker for all Southern blot experiments.
-
bioRxiv - Genetics 2022Quote: ... DIG-labeled (Roche 11218590910) was used as the marker.
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche). Subsequent probes were cleaned up using the RNA Clean Up kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... the recombinant protein was expressed in HEK293T cells and released by 100 μM digitonin in PBS with protease inhibitor cocktail (Roche). The cell lysate prepared with the same method from HEK293T was used as the negative control.
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hybridization signals were detected with anti-mouse secondary antibody labeled with alkaline phosphatase using NBT/BCIP substrates (Roche Biochemical, Mannheim).
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Biochemistry 2019Quote: ... with 35S-labeled methionine (Roche). In vitro translated target proteins were incubated with Flag-tagged Swi6 at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... with Digoxin-labeled Uridine (Roche) and other reagents according to the instructions for T7 RNA polymerase ...
-
bioRxiv - Biochemistry 2021Quote: Digoxygenin-labeled RNA probes (Roche) were generated by in vitro transcription from plasmids containing fragments of murine Shh and Sox9 ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was integrated into antisense and sense probes during in vitro transcription by T7 polymerase (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and labeled with digoxigenin (Roche). In situ hybridization was performed as previously described (Piacentino et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was used to label antisense and sense probes generated by T7 polymerase (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 1% FCS and 12.5µg/ml DNAse (Roche) in IMDM (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... tagged cDNA synthesized using the KAPA mRNA HyperPrep kit (Roche). The prepared libraries were sequenced on an Illumina NextSeq 500 using High Output Flowcell Cartridge from the NextSeq 500/550 Output v2 kit (75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... Biotin-labeled SRSF5 (Bio-SRSF5) was transcribed in vitro with biotin-RNA-labeled mixture (Roche) and T7 RNA polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Cell Biology 2019Quote: GFP-Pav and Tum proteins were incubated with mouse anti-GFP antibody (Roche) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Immunology 2023Quote: ... 100 units/mL recombinant IL-2 (Roche), and 5 μg/mL PHA (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: 20,000 endogenously tagged HEK293T cells were grown on a fibronectin (Roche)-coated 96-well glass bottom plate (Cellvis ...
-
bioRxiv - Genetics 2021Quote: ... plus 1µI of alkaline phosphatase tagged anti-fluorescein F(ab) (Roche), followed by four washes at RT in 100 mM Tris pH7.55 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2020Quote: ... with Biotin pre-labeled Uridine (Roche) and other reagents according to protocol for T7 RNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Labelling and detection used random prime labelling incorporating fluorescein tagged dUTP (Roche). Following probing ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...