Labshake search
Citations for Roche :
51 - 100 of 308 citations for Recombinant Human ANGPTL5 GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... GFP- or HA3x-tagged proteins were detected using α-GFP (1:1000; Roche) or α-HA3x (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with recombinant DNASE I (1000 U) (Roche, 0453628001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the treatment with recombinant DNase I (Roche). 1 µg of the obtained RNA was used for cDNA synthesis using Superscript III (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Immunology 2023Quote: ... and 50 ng/mL recombinant DNase I (Roche Diagnostics) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Cell Biology 2019Quote: ... Cells expressing GST fusion proteins were resuspended in PBS containing protease inhibitor cocktail (Roche Diagnostics, Penzberg, Germany) and lysed by lysozyme treatment (1 mg/ml ...
-
bioRxiv - Microbiology 2019Quote: ... GRA16HA (and other HA-tagged proteins) was detected using rat anti-HA antibodies (Roche) while GRA24MYC was detected using rabbit anti-MYC tag antibody 9E10 (Santa Cruz Biotechnology) ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected with a mouse anti-GFP antibody (1:5000; Roche). Immunoblot results were quantified using Image J software (v1.8.0).
-
bioRxiv - Biochemistry 2020Quote: ... GFP-tagged proteins were detected with a primary mouse antibody IgG1K Anti-GFP (Roche) diluted to 1:1000 in 5 % (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation (IP) of HA-tagged proteins was performed using Anti-HA Affinity matrix (Roche) under denaturing conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoprecipitation of GFP/YFP-tagged proteins was performed with anti-GFP antibodies (11814460001, Roche) using a method we previously described (Ishii and Akiyoshi ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... the pool was loaded in 0.5 mL GST resin mixed with 1 mL of cOmplete His-tag purification resin (Roche) stacked in a 12 mL polyprep column ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...