Labshake search
Citations for Roche :
51 - 100 of 6260 citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and 120 min after glucose load and analyzed with reactive strips in a glucosimeter (Accuchek Performa, Roche®).
-
bioRxiv - Immunology 2023Quote: ... Blood glucose levels were measured in mice with glycosuria (>110 mmol/L) using Advantage II Glucose strips (Roche). Animals displaying two consecutive blood glucose measurements of ≥ 15mmol/L were considered diabetic.
-
bioRxiv - Cell Biology 2020Quote: ... BrdU Cell Proliferation ELISA assay (Roche, 11647229001) was used to assess the proliferation of RKO and DLD1 cells according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Cancer Biology 2019Quote: BSA Protein Assay Kit (A8020-5, Roche, Basel, Switzerland) was applied to measure the protein concentration after lysing BC cells with RIPA buffer ...
-
bioRxiv - Molecular Biology 2021Quote: Blood glucose was measured from euthanized mice during the blood collection using Roche’s strip-based glucometer (Accu-Chek Performa, Roche). Serum β-HB and TG were measured using β-HB (Ketone Body ...
-
bioRxiv - Microbiology 2020Quote: ... Other clinical urine markers were measured by using Combur10 Test®M semiquantitative test strips (Roche Diagnostics GmbH, Germany). Each test strip consists of colorimetric reaction spots for 10 markers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the blood was collected directly on the test strips inserted in the glucometer (Accu-Chek® Performa, Roche, Germany). After blood collection ...
-
bioRxiv - Microbiology 2022Quote: ... bilirubin and occult blood) was measured by Cobas6500 urine dry chemical analysis system and supporting test strips (Roche, Switzerland). For the Coagulation indicators ...
-
bioRxiv - Immunology 2020Quote: ... Parasite cultures were confirmed to be free of mycoplasma and acholeplasma using an ELISA-based Mycoplasma Detection Kit (Roche) which contains polyclonal antibodies specific for M ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Microbiology 2019Quote: ... After washing with 1xPBS containing 0.1% v/v Tween-20, PIP–strips were incubated (1h, RT, agitated) with a monoclonal anti-HA antibody (clone 3F10, monoclonal antibody from Roche) at a dilution of 1:500 in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: Mice were monitored for diabetes weekly by testing for glycosuria using colorimetric Diabur-Test 5000 strips (Roche, Boulogne-Billancourt, France). Overt diabetes was confirmed by testing for fasting glycemia >250 mg.dL-1 (Accu-Check ...
-
bioRxiv - Physiology 2023Quote: ... Blood glucose was determined using a commercial blood glucose meter and test strips (Accu-Chek Performa, Roche Diabetes Care, Inc) and after centrifugation plasma was snap frozen and stored at -80°C until further processing ...
-
bioRxiv - Immunology 2024Quote: ... A drop of blood from the nicked tail vein was used to determine the basal glucose concentration using AccuChec Instant test strips (C216796165-IMP, Roche) after six hours of fasting for GTT and without fasting for ITT ...
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Cell Biology 2020Quote: ... baseline glucose was measured in all animals using a drop of blood from a tail snip wound and Accu-check active glucometers and test strips (Roche Diagnostics). Then ...
-
bioRxiv - Biochemistry 2022Quote: An amount of 0.5 ml of whole blood taken from the lithium heparin bottle was used to analyse lactate levels using rapid Accutrend Plus diagnostic meter and BM Lactate test strips (Roche Diagnostics). Accutrend Plus diagnostic meter employs colorimetric lactate oxidase/mediator reaction and has a record of high reproducibility when compared with laboratory diagnosis.(12)
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was measured by determining the extent of 5-Bromo-2’-deoxy-uridine (BrdU) incorporation into DNA of U87-MG cells using the BrdU cell proliferation assay ELISA kit (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and Cell Death ELISA (Roche, 11774425001, plasma dilution 1:2) which estimates cytoplasmic histone-associated DNA fragments (mono-and oligonucleosomes ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Reagent for ELISA (BRE) (11112589001) was manufactured by Roche. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking reagent for ELISA (BRE, cat. 11112589001) was from Roche. DC Assay kit was from Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: Blood was sampled in mice by nicking the tail vein and blood glucose levels were measured using ACCU-CHEK Active test strips read by an ACCU-CHEK Active meter (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: Blood glucose measurements were collected with a glucometer (ACCU−CHEK Performa, USA) and the proper test strips (F. Hoffmann-La Roche AG, Basel, Switzerland). Blood lactate was also measured with the Lactate Pro 2 handheld device and respective test strips (AKRAY Europe B.V. ...
-
bioRxiv - Bioengineering 2021Quote: ... The blood glucose levels of ZDF rats in each group were measured using a digital glucose meter and test strips (Accu-Chek® Sensor, Roche Inc., Mannheim, Germany) 2 or 3 days prior to surgery and at the study endpoint ...
-
bioRxiv - Neuroscience 2021Quote: ... Glycemia was assessed with blood obtained at decapitation using a glucometer with reagent strips (ACCU-CHEK ® Aviva Nano; Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... A tail vein blood sample was applied on Accu-Chek® Performa Test strip (Cat# 06454038020) and glucose concentration was measured with Accu-Chek® Performa (Cat# 05894964014) blood glucose meter (both from Roche Diagnostics, Manheim, Germany).
-
bioRxiv - Biochemistry 2022Quote: ... pH 7.5 and various concentrations of ADP-ribose or hit compounds were mixed on ice in 384-well PCR plate (Roche). Fluorescent signals were measured from 25 to 95 °C in 0.2 °C/30/Sec steps (excitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection of 106 cells in a 6-well plate was performed using 5 μl of transfection agent (X-tremeGENE HP Reagent, Roche), 10 μL of bacmid and 85 μL of SF900II-SFM medium (Gibco) ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used a cell death detection ELISA (Roche Molecular Systems, Inc.), which is an analytical quantitative sandwich enzyme immunoassay technique that uses the interaction the mouse monoclonal antibodies with DNA and histone to detect internucleosomal fragmented DNA ...
-
bioRxiv - Cell Biology 2019Quote: Cells proliferation was assessed by BrdU Cell proliferation ELISA from Roche. IL-6 ELISA was from Affimetrics ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was evaluated using a colorimetric Cell Proliferation ELISA (Roche), based on the measurement of the incorporation of bromodeoxyuridine (BrdU ...
-
bioRxiv - Immunology 2020Quote: ... 30 μl/well of BM Chemiluminescence ELISA substrate (Roche, 1:50) was added to the plate ...
-
bioRxiv - Biochemistry 2023Quote: Cell proliferation was determined using a colorimetric Cell Proliferation ELISA (Roche) kit ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5-Bromo-2’-deoxy-uridine Labelling and Detection Kit II (Roche, UK) was used per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... Blots were hybridized with a digoxygenin (DIG)-labeled ZmPEPC promoter-specific probe synthesized using primers (Fwd 5’-TCCCGAGTTCCTAACCACAG; and Rev 5’-GTGGCTGAGGCTTCTTTTTG) and the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Switzerland). The signals were detected by CDP-Star (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Microbiology 2023Quote: ... using white LightCycler480 Multiwell Plate 96 plates (Roche). One 20 µl reaction contained 250 nM of hydrolysis probe ...
-
bioRxiv - Pathology 2019Quote: ... 60 min and 120 min after glucose treatment were examined using commercial blood glucose test strips (ACCU-CHEK®, Roche Diabetes Care GmbH, Shanghai, China). For insulin resistance detection ...
-
bioRxiv - Pathology 2020Quote: Fasting blood glucose was measured in blood samples from the tail vein using a glucometer and reactive strips (Accu-Chek® Performa, Roche LTDA. Jaguaré, SP, Brazil). Body weight ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...