Labshake search
Citations for Roche :
51 - 100 of 129 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and precB5R-N+GPC by using X-tremeGENE 9 (Roche Diagnostics K.K., Tokyo, Japan). Cells transfected with each plasmid were then infected with m8 at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8% CHAPS with a cOmplete™ protease inhibitor cocktail tablet added (Roche, cat n°11697498001) for 10 min on ice and centrifuged for 15 min at 16,000 x g at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... with a primary antibody for α-syn (Novocastra N-ASYN, clone KM51, Roche; 1:25) and a secondary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using with FastStart Universal SYBR Green Master Mix (Roche, Cat. N° 4385610). Primers (Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated O/N in the same solution containing 1:2,500 anti-digoxigenin antibody (Roche). The next day the embryos were washed in TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... Remaining lysate was rotated O/N with 25 µl of Protein-A-agarose beads (Roche) and 2 µg of mouse anti-HA antibody (Supplementary Table S1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% n-dodecyl β-D-maltoside [DDM] and 1X cOmplete™ EDTA-free protease inhibitor (Roche)) and incubated at 4°C for 30 mins ...
-
bioRxiv - Genomics 2021Quote: ... Second-stage digestion of SUMOylated peptides was performed with 1 μg of Endoproteinase Asp-N (Roche). Digestion was performed overnight ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Plant Biology 2023Quote: ... supplemented with 1% n-dodecyl β-D-maltoside (DDM) and protease inhibitor cocktail (4693116001, Roche, USA). Homogenization was achieved by gently mixing on ice for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 10ng of total RNA were processed using the KAPA mRNA HyperPrep Kit (Roche p/n KK8580) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The recognized protein bands were visualized by 3,3 N-Diaminobenzidine tertrahydrochloride (DAB) solution staining (Roche, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... before being spotted in 2.5 mcl drops onto a dry nylon membrane (Hybond-N+, Roche 11417240001). Biotinylated oligo-dT (Promega Z5261 ...
-
bioRxiv - Physiology 2022Quote: ... using the LightCycler FastStart DNA Master plus SYBR Green I kit (catalog n° 03515869001, Roche, Basel, Switzerland). 40ng of reverse transcribed RNA was used as template for each reaction ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts were quantified by using LightCycler® 480 SYBR Green I Master Mix (Roche, Cat. N: 04707516001) with the appropriate primers (see key resource table ...
-
bioRxiv - Physiology 2020Quote: ... the boiled samples were supplemented with 0.8% NP-40 and 1 Unit of N-glycosydase F (Roche) in a final volume 50ul and incubated at 37°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% n-dodecyl β-D-maltopyranoside (DDM) and 1 mM EDTA supplemented with protease inhibitor tablets (Roche) and 1 mM PMSF for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the polyclonal murine anti N-terminal MSPDBL2 serum and a rat monoclonal α-HA antibody (Roche 3F10) were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20mM β-glycerophosphate and a cOmplete™ EDTA-free protease inhibitor cocktail tablet added (Roche, cat n°11873580001). In case of HAP1 lysates ...
-
bioRxiv - Molecular Biology 2019Quote: ... The membrane was incubated overnight (O/N) at 4°C with mouse anti-α-tubulin (Roche, loading control) at 1:4000 ...
-
bioRxiv - Microbiology 2022Quote: Bacterial DNA was extracted and purified using the High Pure PCR Template Preparation kit (Roche, cat. n° 11796828001) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... After two washes with cold PBS the cells were collected in the Lysis buffer (5 mM PIPES pH 7.5, 85 mM KCl, 0.5% NP40, 20 mM N-ethyl maleimide [NEM] and protease inhibitor cocktail [04693159001, Roche]) and incubated at 4°C for 10 minutes with rotation ...
-
bioRxiv - Immunology 2021Quote: ... in combination with the N-gene (inhouse primer sets in multiplex PCR) on LightCycler® 480 (Roche Diagnostics).
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 mM N-ethylmaleimide and Complete protease inhibitor cocktail (Roche, one tablet/10 ml of buffer). HA-tagged ubiquitin was purified using Pierce anti-HA magnetic beads (clone 2–2.2.14) ...
-
bioRxiv - Cell Biology 2024Quote: All qPCR reactions were performed with a LightCyler 1.3 Real-Time PCR system (Roche S/N: 140 6143). The MgCl2 concentration (1-3 mM ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA samples were separated on 1% agarose formaldehyde gels and transferred to Hybond-N membranes (Roche Molecular Biochemicals). Membrane hybridization was carried out overnight at 65°C using digoxigenin-labeled riboprobes corresponding to PVX CP sequences.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice (n=2 per group) were randomly assigned to receive either diazepam (synthesized by F. Hoffmann-La Roche) 0.3 ...
-
bioRxiv - Genomics 2020Quote: ... all multiplexed single-cell libraries (n = 30) were quantified using the KAPA Library Quantification Kit for Illumina Platforms (Roche) and pooled in an equimolar ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was incubated for o/n with 40μl of anti-HA agarose beads (rat anti-HA, 3F10 Roche) at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg of total RNA was separated on a denaturing 1.2% agarose gel and blotted on a Hybond-N+ (Roche) membrane ...
-
bioRxiv - Microbiology 2020Quote: ... separated by electrophoresis in a 0.8% agarose gel and transferred onto a nylon membrane (Hybond N+, Roche Molecular Biochemicals). The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cells extract was isolated using RIPA buffer (NaCl 150mM – Tris HCL pH7,35 50mM – DOC 1% – N-P40 1% – H2O) supplemented with protease inhibitor (04 693 116 001, Roche). Isolated protein concentration was determined using Bradford assay (500-0006 ...
-
bioRxiv - Genetics 2020Quote: ... pellets were thawn and re-suspended in 400 μl of lysis buffer (50mM HEPES pH7.5, 150mM NaCl, 5mM MgCl2, 40mM N-Ethylmaleimide, EDTA-free protease inhibitor cocktail (Roche) and 2mM PMSF (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...