Labshake search
Citations for Roche :
51 - 100 of 1996 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol) supplemented with 5% v/v beta mercaptoethanol and 1x protease inhibitor cocktail (Roche) was added to each sample followed by centrifugation at 18,000×g at 4 °C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... lysed by sonication as described above and loaded onto the cOmplete His-tag purification column (Roche). The complex was eluted in 300 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified cell lysates were incubated with 10 mL of cOmplete His-Tag purification resin (Roche, Germany) for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein eluted after immobilized metal affinity chromatography (IMAC) using complete His-tag purification resins (Roche) was concentrated using 10KDa cut-off amicon filters (Merck ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the supernatant was further incubated with 25 μl of cOmplete His-tag purification resins (Roche, Switzerland) at 4 °C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... the cleared lysate was added to 1 mL cOmplete His-Tag Purification Resin (COHISR-RO, Roche) that had been pre-washed with buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... CrCEP19107-195 were performed by loading the cleared lysate onto an IMAC cOmplete His-Tag 5ml column (Roche) pre-equilibrated in 5 column volumes (CV ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified from filtered cell supernatants using StrepTactin resin (IBA) or cOmplete His-Tag Purification Resin (Roche) or Jacalin (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... Cell lysates were loaded onto a nickel immobilized metal affinity chromatography column (cOmplete His-Tag Purification Resin, Roche) and eluted with 250 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified cell lysate was bound to 10 mL of cOmplete His-Tag purification resin (Roche, Germany, 30 min), washed with 1 L base buffer ...
-
bioRxiv - Biophysics 2020Quote: ... the pool was loaded in 0.5 mL GST resin mixed with 1 mL of cOmplete His-tag purification resin (Roche) stacked in a 12 mL polyprep column ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified supernatant was filtered through a 0.45 μM PES syringe filter and incubated with 10 mL of cOmplete His-Tag purification beads (Roche) for 1 h with gentle rocking ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein was eluted with wash buffer containing 10 mM maltose and subsequently bound to c0mplete His tag resin (Roche) for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was then used in a batch purification protocol by addition of cOmplete His-Tag resin (Roche; 5893682001) for 1 hr at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Expressed proteins in the cell-culture supernatant were purified using a cOmplete His-Tag Purification Resin (Roche, Cat# 5893682001) affinity column ...
-
bioRxiv - Microbiology 2023Quote: ... Expressed proteins in the cell-culture supernatant were purified using a cOmplete His-Tag Purification Resin (Roche, Cat# 5893682001) affinity column ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA from patients NL and BAR was analysed using a custom fine tiling array covering the alpha- and beta-globin gene clusters and surrounding areas was used (Roche NimbleGen, Madison, WI, USA). Array design was based on NCBI Build 36.1 (hg18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Clear supernatant was incubated with 2 ml of pre-equilibrated Ni-beads (cOmplete™ His-Tag Purification Resin, Roche, Switzerland) for 1 h and then transferred to a sigma column to be washed consecutively with His-binding buffer (50 mM HEPES pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified supernatant was filtered through a 0.45 μM cartridge filter and incubated with 10 mL of cOmplete His- Tag purification beads (Roche, Germany) for 45 min ...
-
bioRxiv - Biophysics 2022Quote: ... The recombinant human Sox6 HMG domain was purified from supernatant of bacterial lysate by using NiNTA resin (Complete His-Tag purification Resin, Roche) and followed by SP sepharose column chromatography (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... His – tagged SARS-CoV2 S trimers were purified using a two-step purification protocol by 1 mL or 5mL cOmplete His-tag columns (Roche). Proteins were further purified by size-exclusion chromatography using a HiLoad Superdex 200 16/600column (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then processed by immobilized metal affinity chromatography (IMAC) on a gravity column containing 2 mL bed volume of cOmplete His Tag purification resin (Roche). After loading the lysate ...
-
bioRxiv - Immunology 2022Quote: The protein of interest was captured from the clarified conditioned medium by IMAC using a cOmplete His-Tag purification column (Roche) and further purified by SEC using preparative grade HiLoad 16/600 Superdex 75 columns (Cytiva ...
-
bioRxiv - Biochemistry 2023Quote: ... SUPREM variants were purified by affinity chromatography in an open column using cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland), eluting with 20 mM HEPES pH 7.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded on a column filled with cOmplete His-tag Purification Resin (Roche Diagnostics GmbH, Mannheim, Germany) and pre-equilibrated with lysis buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
Serine-ubiquitination regulates Golgi morphology and the secretory pathway upon Legionella infectionbioRxiv - Cell Biology 2020Quote: ... His (Roche), GRASP55 (Proteintech) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Biophysics 2022Quote: ... 200 mM NaCl, 5 mM Beta glycerophosphate, 0.1 mM sodium orthovanadate, 2 mM TCEP, 0.4% NP40, 1X Roche EDTA free mini complete protease inhibitor) ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... HA tag (Roche, #12013819001 or Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2020Quote: HA tag (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM imidazole and 500 μL cOmplete Hig-tag purification Resin (obtained from Roche, ref 05893682001). The mixture was gently shaken at 4°C for 4 h in dark ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% beta-mercaptoethanol and protease and phosphatase inhibitors (Roche Complete Mini protease inhibitor, Sigma-Aldrich #11836153001, and Roche Complete Ultra phosphatase inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...