Labshake search
Citations for Roche :
51 - 100 of 260 citations for GAPDH Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Immunology 2023Quote: ... and 50 ng/mL recombinant DNase I (Roche Diagnostics) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Cell Biology 2022Quote: ... from BD Biosciences, mAb anti-HA-tag (11867423001; IF: 1/500, WB: 1/2000) from Roche, mAb anti-mRFP/DsRed2 (sc-101526 ...
-
bioRxiv - Biochemistry 2024Quote: ... Primary antibodies used were anti-c-myc (11667149001, 9E10 mAb from Roche; 1:250), anti-α-Tubulin (T5168 Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Molecular Biology 2020Quote: ... Immunoblotting was performed following standard procedures with the following antibodies: anti-GFP mAb (Roche, #11814460001), anti-GFP pAb (Abcam #ab290 and Invitrogen #A11122 ...
-
bioRxiv - Microbiology 2022Quote: ... Rodent GAPDH was used as housekeeping gene using the LightCycler 480 (Roche, Anderlecht, Belgium). The activation cycle was at 95 °C for 10 minutes ...
-
bioRxiv - Immunology 2019Quote: ... and was compared to amplification of gapdh using Universal Probe Library probe #80 (Roche) with forward primer tgtccgtcgtggatctgac and reverse primer cctgcttcaccaccttcttg ...
-
bioRxiv - Immunology 2020Quote: ... GAPDH was analyzed by one-step SYBR Green RT-qPCR (Kapa Biosystems, Wilmington, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Biochemistry 2023Quote: HDX of unbound and bound c-Met (1:2.2 ratio with mAb (Roche Diagnostics GmbH, Germany)) was performed by diluting c-Met into labelling buffer (20mM Histidine ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins with HA-tag(s) were detected using rat mAb-anti-HA 3F10 (Roche, 1:1000) as primary antibody and IRDye® 800CW Goat anti-Rat IgG (Licor ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used for IFA were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:200) (Roche); mouse anti-PMV mAb (1:50) ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Slide were moved to a humid chamber and blocked with blocking solution (MAB 1×, blocking reagent (Roche) 2% ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was probed using the primary antibodies mAb mouse α-GFP (1:1’000, Roche Diagnostics #11814460001), mAb mouse α-PfGAPDH (1:20’000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... pH 7.5) and placed in RBR buffer (20% Goat serum, 2% Roche Blocking Reagent in 1x MAB) on the orbital rocker for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... ADCC in no click or click mAbs conditions was evaluated using the Cytotoxicity Detection Kit (LDH, Roche) as instructed by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies used for IFA were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:200) (Roche); rabbit anti-GAP45 mAb (1:1000).
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Systems Biology 2021Quote: Recombinant proteins were purified using the Anti-Protein C Affinity Matrix (11815024001, Roche) on an ASPEC liquid handling instrument (Gilson) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Residual genomic DNA contamination was removed by treatment with recombinant DNAse I (Roche). cDNA was generated using Superscript II reverse transcriptase and Oligo d(T ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Microbiology 2023Quote: DNase treatment was performed using recombinant RNase-free DNase I (Roche, Basel, Switzerland) according to the manufacturer’s protocols for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...