Labshake search
Citations for Roche :
51 - 100 of 1222 citations for 6 9 Diphenyl 9H carbazol 3 yl 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Real-time fluorescence-monitored quantitative PCR using the primer pair 5′-CCTATC ACCCTTGCCA-3′ and 5′-GAGGCTGTTGCTTGTG-3′ was performed on a LightCycler 96 System (Roche, Basel, Switzerland). Each reaction of 20 µL consisted of 10 µL of SYBR Green I (Roche) ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3× EDTA-free complete protease inhibitor cocktail (Roche). Lysates were briefly sonicated until the protein solution was clear ...
-
bioRxiv - Cancer Biology 2022Quote: ... incubated with blocking buffer containing 3 % BSA (Roche Diagnostics), 5 % goat serum (Jackson ImmunoResearch Laboratories) ...
-
bioRxiv - Neuroscience 2020Quote: Clonazepam (CAS #1622-61-3) was bought from Roche on 2018 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Biophysics 2024Quote: ... 20 mM imidazole) supplemented with 3 protease inhibitors (Roche) and then lysed by an EmulsiFlex-C3 (Avestin ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 7.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... pH 7.0 with 0.75 M 6-aminocaproic acid) with freshly added protease inhibitors (Roche). After resuspension ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with 250-800 ng DNA per well of a 12-well plate or 500 ng per well of a 6-well plate using X-tremeGENE 9 DNA transfection reagent (Roche), and harvested after 24 h.
-
bioRxiv - Neuroscience 2021Quote: ... COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X-tremeGENE™ 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirAER (1 μg/well) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with 1 μg Kras or control expression plasmid and 1 μg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 μl of X-tremeGENE 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with 1 ug of shRNA/cDNA and 1 ug of viral packaging plasmids (250ng pMD2.G and 750ng psPAX2) using 6 ul of Xtreme Gene 9 transfection reagent (Roche). After 24 hr ...