Labshake search
Citations for Roche :
901 - 950 of 2588 citations for Rabbit Anti Borrelia burgdorferi sensu stricto B31 Surface Lipoprotein P27 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Beads were removed by centrifugation (twice at 1,000 xg) and then pre-cleared lysates were supplemented with anti-HA high affinity monoclonal antibody (clone 3F10, Roche) at 2 µg/ml final concentration along with 20 µl Protein G Sepharose beads and incubated at 4° C for 4 hours on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Signals were detected using anti-mouse secondary antibodies conjugated with alkaline phosphatase using BCIP/NBT substrates (Roche Biochemical, Mannheim). Similarly ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were boiled 5 min and 50 μg of proteins were separated by electrophoresis on 12.5% SDS-PAGE and subjected to immunoanalysis with either anti-GFP antibody (Roche), anti-Pgk1 antibody (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for one hour in donkey anti-mouse FITC antibody (1:200) in 0.3% Triton-X100 supplemented with 1X blocking buffer (Roche). After washing with PBS for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with an anti-DIG antibody conjugated with horse radish peroxidase (HRP) (1/500, Roche Diagnostics) for 6 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was transferred into a new tube and was mixed with mouse monoclonal anti-GFP antibodies (11814460001, Roche) that had been pre-conjugated with Protein-G Dynabeads with dimethyl pimelimidate using a protocol described in (Unnikrishnan et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... transferred to PVDF membranes (Amersham Hybond) and probed with following antibodies: mouse anti-HA-HRP (1:1000) (12013819001, Roche) rabbit anti-EMC6 (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were then blocked for an hour in 5% milk powder/PBS solution and probed with 1:2,500 rat anti-HA mAb 3F10 antibody (Roche) in 5% milk powder/PBS solution overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... with SDS-PAGE and immunoblots performed by standard methods using the following mouse monoclonal antibodies: anti-GFP (11814460001, Roche) and anti-MYC (clone 4A6 ...
-
bioRxiv - Neuroscience 2021Quote: ... ISH detection was performed using anti-DIG secondary antibody conjugated with radish peroxidase (POD) (Roche Diagnostics Corp., Indianapolis, IN) and Opal 570 (1:500 ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... The slides were incubated overnight with a 1:5,000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics). After the slides had been washed in in a solution of 0.1 M Tris (pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transfer membranes were then incubated with a 1:10,000 dilution of primary mouse anti-6xHis antibody (Roche, cat. #11922416001) for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin probes were made by standard protocols and were detected using the anti-DIG POD antibody (Roche, 1:1000) and stained using Cy3-tyramide substrate (Perkin Elmer ...
-
bioRxiv - Plant Biology 2021Quote: ... SMXL5-3xHA and 6xMyc-OBE3 bands were detected by antibodies Anti-HA-Peroxidase High Affinity (3F10) (Roche; Basel, Switzerland) or c-Myc Antibody (9E10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with 1:2000 alkaline phosphatase-conjugated anti-DIG antibodies (Sigma/Roche, 11093274910). After washes and prior to development ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated lamb serum in Tris-buffered saline with 0.1% Tween-20 (TBST) and incubated with alkaline phosphate-conjugated anti-DIG antibody (1:2000, Roche) in blocking buffer overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000; Roche) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2021Quote: ... Tween-20 0.3%) for 1 hour and finally incubated overnight at 4°C with anti-Dig-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for in donkey anti-mouse FITC antibody diluted in 10 X blocking buffer (1:100; Roche) + 0.3 % Triton-X100 for 1 h ...
-
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafishbioRxiv - Developmental Biology 2022Quote: ... The probes labeled by digoxigenin were detected using alkaline phosphatase coupled anti-digoxigenin Fab fragment antibody (Roche, Basel, Switzerland) with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories ...