Labshake search
Citations for Roche :
901 - 950 of 1100 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Pathology 2024Quote: ... Pre-cleared lysates (containing 1 mg of protein) were then incubated with mouse monoclonal anti-GFP antibodies (Roche) coupled to G-protein beads for 3 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: Cell lines: Cells were lysed with RIPA buffer and prepared for total protein extraction with protease inhibitors (Roche). After 20 minutes of centrifugation (>16000g) ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein was captured from the supernatant by affinity chromatography using cOmplete™ His-Tag Purification Resin (Roche), equilibrated with 50 mM sodium phosphate pH 7.8 ...
-
bioRxiv - Genomics 2024Quote: ... Transfer of proteins to a membrane and signal development with horseradish peroxidase-conjugated anti-HA (3F10; Roche 12013819001) or anti-tubulin (Abcam ab-185067 ...
-
bioRxiv - Cell Biology 2024Quote: ... PCMD-1 transgene proteins with GFP-tag were probed with a GFP antibody (mouse monoclonal 1:600, Roche) or α-Tubulin antibody (mouse monoclonal 1:7500 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Localization of HA tagged proteins were analyzed with an anti-HA tag antibody (Roche, clone 3F10, 1 : 500) and Alexa Fluor coupled secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and incubated with a primary antibody (rat anti-HA, Roche, RD11867423001, 1:100) overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were separated on 10%-15% SDS-PAGE gels and transferred to PVDF membranes (Roche, 03010040001). The membranes were probed with the indicated primary antibodies followed by the appropriate HRP-conjugated secondary antibodies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl of antiserum were diluted with 250 μL of PBS containing 0.05% NP-40 and coupled to 10 μl of Protein A-Agarose beads (Roche) by rotating at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates - non-transfected or overexpressing EGFP-tagged proteins -were prepared in lysis buffer (20mM HEPES, 1mM EDTA, 0.2% Triton X-100 and protease inhibitor cocktail (Roche)) briefly sonicated (three times 5 second pulses with 30 seconds rest ...
-
bioRxiv - Microbiology 2021Quote: ... C-reactive protein and D-dimer levels were measured using Cobas Integra 400 plus analyzer (Roche Diagnostics Nederland B.V.).
-
bioRxiv - Cell Biology 2021Quote: The protein contents were extracted utilizing an RIPA lysis buffer (Beyotime, Shanghai, China) and protease inhibitor (Roche, Basel, Switzerland). Next ...
-
bioRxiv - Cell Biology 2021Quote: Protein from 2D hPSC-cardiac cell cultures was extracted using RIPA lysis buffer supplemented with protease inhibitor cocktail (Roche). Protein lysate concentration was estimated using a BCA assay (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Genomics 2020Quote: ... Protein lysates were prepared by manually homogenizing frozen tissue in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Proteins were separated on a 4-20% TGX SDS-PAGE gel (Bio-Rad ...
-
bioRxiv - Pathology 2021Quote: ... 10 mM Na4P2O7) in the presence of protease inhibitors (completeTM, Mini, EDTA-free Protein inhibitor cocktail tablets, Roche, Sigma). Gut tissue and GDE were homogenized in the lysis buffer and sonicated three time for 30 seconds each at 10 μm amplitude ...
-
bioRxiv - Neuroscience 2020Quote: Proteins were extracted using Tris-buffered Saline (TBS) with 0.5% NP40 protein extraction buffer containing protease and phosphatase inhibitors (Roche), on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested and ruptured with a Dounce homogenizer in the buffer A containing cOmplete protein inhibitor cocktail (Roche) and 1mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Microbiology 2023Quote: ... Expressed proteins in the cell-culture supernatant were purified using a cOmplete His-Tag Purification Resin (Roche, Cat# 5893682001) affinity column ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein was eluted with wash buffer containing 10 mM maltose and subsequently bound to c0mplete His tag resin (Roche) for 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: Protein were isolated by using RIPA buffer with protease inhibitor cocktail (cOmplete Protease Inhibitor Cocktail, Roche, Mannheim, Germany, 04693116001), and concentrations were measured using the Qubit Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: Total proteins were extracted from cultured NB cells using RIPA buffer supplemented with protease and phosphatase inhibitor cocktail (Roche). The cell lysates were pre-cleared with protein A or protein G beads (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2022Quote: ... Lysate was precleared with Pierce™ Protein G Agarose and immunoprecipitated with anti-GFP antibodies (Roche Cat. No. 11814460001) bound on protein G agarose ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in extraction buffer (SDS 2%, 50 mM Tris-Cl pH 7.4, 1 mM PMSF, 2x cOmplete protein inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative Western blot analysis was employed to determine concentration of recombinant protein using a recombinant GFP standard (Roche, 11814524001) with a defined concentration of 1 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... Expressed proteins in the cell-culture supernatant were purified using a cOmplete His-Tag Purification Resin (Roche, Cat# 5893682001) affinity column ...