Labshake search
Citations for Roche :
901 - 950 of 2594 citations for Anti P2Y12 Platelet ADP Receptor antibody produced in rabbit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... The sections were incubated with sheep anti-DIG antibody (1:200, Roche Applied Science; cat. no 1333 089), biotinylated donkey anti-sheep antibody (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated with an alkaline phosphatase-conjugated anti-digoxigenin antibody (1:1500 in blocking solution; Roche, Switzerland) overnight at RT ...
-
bioRxiv - Microbiology 2020Quote: ... permeabilized and immunostained with the following primary antibodies - rat monoclonal anti-HA (clone 3F10, Roche: 1:250 dilution), mouse monoclonal anti-myc (clone 9B11 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then incubated with primary antibodies used at the following dilutions: mouse-anti-HA (Roche, 1:300), rabbit-anti-γ-H2A.X (Cell signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lysate was incubated with agarose beads conjugated with either mouse IgG or mouse anti-GFP antibodies (Roche) for 3h at 4°c under gentle agitation ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Pathology 2024Quote: ... Pre-cleared lysates (containing 1 mg of protein) were then incubated with mouse monoclonal anti-GFP antibodies (Roche) coupled to G-protein beads for 3 h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Detection of DIG-labeled probes were performed by incubation with a mouse monoclonal anti-DIG primary antibody (Roche), followed by incubation with Cy3-labeled goat anti-mouse IgG secondary antibody (EMD Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl and 0.1% (v/v) Tween 20] and probed with anti-GFP mouse monoclonal antibodies (Roche) followed by goat anti-mouse horseradish peroxidase (HRP ...
-
bioRxiv - Developmental Biology 2024Quote: ... Localization of HA tagged proteins were analyzed with an anti-HA tag antibody (Roche, clone 3F10, 1 : 500) and Alexa Fluor coupled secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... Signals were detected using anti-mouse secondary antibodies conjugated with alkaline phosphatase using BCIP/NBT substrates (Roche Biochemical, Mannheim). Similarly ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for one hour in donkey anti-mouse FITC antibody (1:200) in 0.3% Triton-X100 supplemented with 1X blocking buffer (Roche). After washing with PBS for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...