Labshake search
Citations for Roche :
901 - 950 of 2600 citations for Anti CD123 Antibody FITC labled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Genomics 2021Quote: ... The purified PCR products of Cen-524 and Tel-190 were labeled with Cy5-dUTP and FITC-dUTP using Nick Translation Mix (Roche, Mannheim, Germany), respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Beads were removed by centrifugation (twice at 1,000 xg) and then pre-cleared lysates were supplemented with anti-HA high affinity monoclonal antibody (clone 3F10, Roche) at 2 µg/ml final concentration along with 20 µl Protein G Sepharose beads and incubated at 4° C for 4 hours on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Signals were detected using anti-mouse secondary antibodies conjugated with alkaline phosphatase using BCIP/NBT substrates (Roche Biochemical, Mannheim). Similarly ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were boiled 5 min and 50 μg of proteins were separated by electrophoresis on 12.5% SDS-PAGE and subjected to immunoanalysis with either anti-GFP antibody (Roche), anti-Pgk1 antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with an anti-DIG antibody conjugated with horse radish peroxidase (HRP) (1/500, Roche Diagnostics) for 6 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was transferred into a new tube and was mixed with mouse monoclonal anti-GFP antibodies (11814460001, Roche) that had been pre-conjugated with Protein-G Dynabeads with dimethyl pimelimidate using a protocol described in (Unnikrishnan et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... transferred to PVDF membranes (Amersham Hybond) and probed with following antibodies: mouse anti-HA-HRP (1:1000) (12013819001, Roche) rabbit anti-EMC6 (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were then blocked for an hour in 5% milk powder/PBS solution and probed with 1:2,500 rat anti-HA mAb 3F10 antibody (Roche) in 5% milk powder/PBS solution overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... with SDS-PAGE and immunoblots performed by standard methods using the following mouse monoclonal antibodies: anti-GFP (11814460001, Roche) and anti-MYC (clone 4A6 ...
-
bioRxiv - Neuroscience 2021Quote: ... ISH detection was performed using anti-DIG secondary antibody conjugated with radish peroxidase (POD) (Roche Diagnostics Corp., Indianapolis, IN) and Opal 570 (1:500 ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... The slides were incubated overnight with a 1:5,000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics). After the slides had been washed in in a solution of 0.1 M Tris (pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then washed in KPBS and incubated with rabbit anti-FG antibody (1:5000; Chemicon International, Calif, USA) in 0.5% Blocking Reagent (Roche) in KPBS for 16 h at 4 ° C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transfer membranes were then incubated with a 1:10,000 dilution of primary mouse anti-6xHis antibody (Roche, cat. #11922416001) for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin probes were made by standard protocols and were detected using the anti-DIG POD antibody (Roche, 1:1000) and stained using Cy3-tyramide substrate (Perkin Elmer ...
-
bioRxiv - Plant Biology 2021Quote: ... SMXL5-3xHA and 6xMyc-OBE3 bands were detected by antibodies Anti-HA-Peroxidase High Affinity (3F10) (Roche; Basel, Switzerland) or c-Myc Antibody (9E10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Genomics 2021Quote: ... Samples were then incubated overnight at 4°C with a rabbit anti-DIG HRP-conjugate antibody (1:500, Roche). Then ...