Labshake search
Citations for Roche :
901 - 950 of 7464 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... RNA was digested with DNase-free RNase (5 μg/ml, Roche #11119915001) for 1 hour at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% Glycerol and EDTA free protease inhibitor cocktail tablet/50ml (Roche, UK)] ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA) with freshly added protease inhibitor cocktail (Roche, cat #11836170001). Lysates were passed through a 26G syringe and protein was quantified by DC Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol (v/v%)) and dispensed into white 96-well plates (Roche). Compound (1 mM ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 μL of FastStart SYBR Green Master (Roche Diagnostics, Indianapolis, IN USA), 0.4 μL of qRT-PCR primers (Table S1) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Blocking was performed with 5 % Bovine serum albumin (Boehringer Mannheim, now Roche) in 1x PBST (1x PBS with 0.05 % Tween-20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5µL SYBR Green I Master mix (5 mL: Roche Diagnostics, Indianapolis, IN) and 2 µL of distilled and deionized H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 µL of 5 µM dT overhang adapter (Roche, cat. no. KK8727) was used for the End Prep reaction ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were blocked in 5% BSA (Roche, 10 735 086 001) in TBS-T before overnight incubation at 4°C with primary antibodies ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Genomics 2023Quote: ... and 0.08U KAPA2G Robust HotStart DNA Polymerase (5 U/mL, Roche KK5517). PCR reactions were performed using a thermocycler with the following conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM β-mercaptoethanol (buffer A) with Complete protease inhibitor cocktail (Roche) and 2 mg DNAse I from bovine pancreas (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μM LMD-009 and EDTA-free protease inhibitor cocktail tablets (Roche). Then the suspension was incubated at room temperature for 1.5 h after adding apyrase (25 mU/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM NaF and 5 mM Na3VO4) containing protease/phosphatase inhibitors (Roche). Cells were incubated in lysis buffer for 2-3 hours in rotator at 4°C ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.5% Triton X-100, 100 mM NaF, 1 mM ortho-vanadate, 2 mM EDTA, and a protease inhibitor cocktail [Roche 11836153001]). Lysates were vortexed and cleared by centrifugation (15,000 x g for 15 min at 4°C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were pelleted by centrifugation at 2500g for 5 minutes and resuspended in 880ul Nuclear Lysis Buffer (50mM Tris HCl, 10mM EDTA, 1% SDS, 1X protease inhibitors (Roche, 04693124001)) ...
-
bioRxiv - Molecular Biology 2019Quote: Re-amplification of primary WTA products was performed in a reaction volume of 50 μl comprising 5 μl Expand Long Template Buffer 1 (Expand Long Template PCR System, Roche Diagnostics), 6 μl of CP2-15C or CP2-9C primer (2.88 μM ...
-
bioRxiv - Immunology 2020Quote: ... The resulting membrane pellet was resuspended in ice cold 500 μl TNE buffer (10 mM Tris/Cl [pH 7.4], 150 mM NaCl, 5 mM EDTA, 1% Triton X-100 [Sigma], 10X protease inhibitors [Complete tablets, Roche, Indianapolis, IN]). Sucrose gradients for the preparation of lipid rafts were assembled previously described (18) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed with buffer MB#1 (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche complete EDTA-free). Chromatin was fragmented with MNase for 10 min at 37°C and digestion was stopped with 5 mM EGTA at 65°C for 10 min ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Microbiology 2023Quote: ... Cross-linked cells were lysed by sonication in lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche). Cell lysates were treated with 2 units of Turbo DNase (Life Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA, 10 mM β-mercaptoethanol, 10 mM Hepes pH 7.5, supplemented with 1× Complete protease inhibitor cocktail, Roche, Germany), passed through 27 G syringe and left 20 min in ice ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...