Labshake search
Citations for Roche :
851 - 900 of 7724 citations for 6 Chloro 1 2 4 triazolo 4 3 b pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: All qPCR reactions were carried out using 384-well plates in 3 technical replicates in 10 µl final reaction volume on the LightCycler 480 System II (Roche). Reaction mix consisted of Power Track SYBR Green Master Mix 2X ...
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Immunology 2023Quote: Single cell suspensions of whole lungs were lysed with Laemmli buffer (10% glycerol, 3% SDS, 10 mM Na2HPO4) with protease inhibitor cocktail (Roche). Proteins were separated on a 12% SDS-PAGE gel and electro transferred onto PVDF membranes ...
-
bioRxiv - Developmental Biology 2024Quote: Primary tissue samples from reduction mammoplasties of healthy women were dissociated through a 3 mg/mL collagenase (Roche Life Science) solution and sorted via density gradient ...
-
bioRxiv - Biochemistry 2020Quote: For Figures 2 and 6: Cells or embryos were lysed in RIPA buffer supplemented with a cocktail of protease inhibitor (Roche). Total protein was resolved on SDS polyacrylamide gels (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... 1% Triton X-100, 2 mM EDTA, 2 mM EGTA, 1 mM PMSF, and complete protease inhibitor cocktail tablet; Roche), incubated with continuous shaking at 4°C for 20 min and then centrifuged at 12 000xg at 4°C for 15 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... The membrane was incubated overnight (O/N) at 4°C with mouse anti-α-tubulin (Roche, loading control) at 1:4000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... in an equal volume of lysis buffer (30 mM HEPES/KOH pH 7.4, 100 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, Protease Inhibitor Cocktail Tablets, EDTA-free, Roche Rnase inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cell Biology 2019Quote: ... washed with PBS and resuspended in lysis buffer (0.5% Triton X-100, 4% w/v SDS, 0.5xPBS) supplemented with protease inhibitor cocktail (Roche). 5xSDS-PAGE loading buffer containing 25 mM dithiothreitol was added to the lysates ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Biochemistry 2020Quote: ... Trypsin-6 (11418025001; Roche), Trypsin-7 (90057 ...
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Biophysics 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... using FUGENE 6 (Roche) and grown in IMDM medium with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2 μg ml−1 collagenase A (Roche), 2.4 U ml−1 dispase I (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 mg ml-1 collagenase/ dispase (Roche) and 0.2 mg ml-1 DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... and 10 U mL−1 IL-2 (Roche) for 48 h at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... and the ketoreductase-B domain of the mycolactone polyketide synthase genes (KR-B) [22] using RT-PCR reagents from Roche PCR Kit (Roche Diagnostics ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After incubation for 1-2 hours in a 1% blocking solution (Roche) dissolved in 1× PBS ...