Labshake search
Citations for Roche :
8501 - 8550 of 10000+ citations for Cow Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: The primary antibodies used in this study included anti-HA (rat, 1:200; 11867423001, Roche), anti-Prestin (goat ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell proliferation was evaluated using the Cell Proliferation Reagent WST-1 (CELLPRO-RO, Roche).
-
bioRxiv - Biophysics 2023Quote: ... Cell Proliferation Reagent WST-1 and Cytotoxicity Detection KitPLUS (LDH) were obtained from Roche (Germany). 5× HOT FIREPol® EvaGreen® qPCR Supermix was acquired from Solis BioDyne (Estonia) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then incubated with the primary antibody (anti-HA, Roche, 11583816001, 1:1000) in TBST + 5% non-fat dry milk overnight at 4 °C followed by incubation with secondary antibodies (Goat anti-Mouse IgG ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 mM DTT (TNMD buffer) supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche). The insoluble myrArf1•GTP was solubilized using 20 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mM β-mercaptoethanol) plus protease inhibitor (Complete Ultra Tablets, Mini, EDTA-free, EASYpack, Roche). Cells were then disrupted by French press cell lysis and centrifugated at 12000 rpm for 1 hour at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were incubated in blocking solution (0.2% Roche block, 10% FBS, 1% DMSO in PBST) for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5% Triton X-100 and 1 EDTA-free protease inhibitor cocktail tablet (Roche: Cat#05056489001) per 50 mL buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Plant Biology 2024Quote: ... the non-specific sites were blocked with 1% Blocking Reagent (Roche, Cat No./ID: 11096176001). The slides were incubated with Anti-Digoxigenin-AP Fab fragment (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... 10% [v/v] glycerol) supplemented with 1× cOmplete EDTA-free protease inhibitor cocktail tablets (Roche). The resuspended cells were incubated on ice for 30 min with 1 mg/mL egg lysozyme and sonicated (50% amplitude ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.1% SDS) supplemented with 1 mM DTT and 1X complete protease inhibitor cocktail (Roche, 11697498001). The cells were incubated on ice in lysis buffer for 30 mins before vortexing followed by centrifugation at 20,000 g for 15 mins at 4°C in a microcentrifuge to remove the cell debris ...
-
bioRxiv - Pathology 2024Quote: ... the DRGs are incubated at 37°C with 1 mg/mL collagenase A (10103578001, Roche) for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Antibodies used in this study for immunoblot detection were rat anti-HA (1:1000, Roche), mouse anti-myc (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... followed by staining of CD3 and PD-1 w with a BenchMark Ultra autostainer (Roche). Tim-3 was stained manually after heat-induced epitope retrieval using the “high pressure” program on an electric pressure cooker (Cuisinart CPC-600 ...
-
bioRxiv - Biochemistry 2024Quote: ... briefly, cells were then resuspended in lysis buffer (50μg/ml lysozyme, 1×protease inhibitor(Roche), 250 U/ml benzonase ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteolysis was run overnight at 37°C with 1:50 (w/w) recombinant trypsin (Roche). The peptides obtained were fractionated in a 44-min chromatographic run (Evosep One ...
-
bioRxiv - Developmental Biology 2024Quote: ... Kidneys were incubated in alkaline phosphatase-conjugated anti-DIG antibody (1:4000, Roche, Cat#11093274910). For in situ detection ...
-
bioRxiv - Plant Biology 2024Quote: ... and then probed with anti-HA-peroxidase at a dilution of 1:2500 (Roche 12013819001) for 1 h at room temperature.
-
bioRxiv - Immunology 2024Quote: ... The slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for library quantitation (Kapa Biosystems, Woburn, MA) both immediately prior to and after library construction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNAseq libraries were prepared in a single batch by the Bauer Core at Harvard using the KAPA mRNA HyperPrep Kit (Roche, Palo Alto, CA) with 300-500 nanograms of input RNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
bioRxiv - Genomics 2020Quote: ... Library concentrations were determined by quantitative polymerase chain reaction (qPCR) using the KAPA SYBR FAST ABI Prism qPCR Kit (Kapa Biosystems, Wilmington, MA) and the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... cDNA libraries were prepared using 500 ng of large RNA as input for the KAPA mRNA HyperPrep Kit (Kapa Biosystems; Wilmington, MA, USA) combined with the KAPA Unique Dual-Indexed Adapter Kit (Kapa Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified in 50 μl reactions containing 150 pmol of P1.1 and P3 primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). The amplification was incubated at 95°C for 45 seconds ...
-
bioRxiv - Pathology 2020Quote: ... the sequence was labeled with digoxigenin using the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics Deutschland GmbH, Germany). After dewaxing in water ...
-
bioRxiv - Physiology 2019Quote: ... PCR was carried out with KAPA SYBR® FAST Universal 2X qPCR Master Mix (Cat# KK4601) / LightCycler 480 SYBR Green I Master kit (Roche Cat# 14712220) in Vapo.Protect Eppendorf LC-480 and LC-96 from Roche system using primer pairs mentioned in Supplementary Table A.
-
bioRxiv - Neuroscience 2021Quote: 100ng of total RNA from each sample was used to prepare total RNA libraries using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems, Massachusetts, USA). Fragmentation prior to first strand cDNA synthesis was carried out using incubation conditions recommended by the manufacturer ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... no AS-MB-006) and RNA libraries were prepared using the KAPA Stranded RNA-seq library preparation kit (Kapa Biosystems, cat. no KK8401) according to manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2021Quote: ... the quantitative real-time PCR (qRT-PCR) reactions were carried out using the KAPA SYBR FAST qPCR kit from Kapa Biosystems (MA, USA) with sfGFP-specific primer sets (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Microbiology 2020Quote: ... 1μg of total RNA was reverse-transcribed to complementary DNA (cDNA) using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantification of mcherry and gyrB (single gene copy on the plasmid and on the chromosomal DNA respectively) copy number was made from 25 pg of DNA using the LightCycler® FastStart DNA Master HybProbe kit (Roche, Bâle, Switzerland) following manufacturer’s instructions with appropriate oligonucleotides and Taqman probes (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Kapa Biosystems Cat#KK4824).
-
bioRxiv - Microbiology 2021Quote: ... to check for size and quantified by qPCR using the Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems, Wilmington, MA, USA). Equimolar quantities of each library were then pooled and sequenced on the Illumina NovaSeq 6000 instrument with a SP flowcell (2 x 250 bp ...
-
bioRxiv - Microbiology 2020Quote: ... the sections were incubated with a primary antibody for 32 min at room temperature and then incubated with the reagent from an iVIEW DAB detection kit (Roche Diagnostics, Meylan, France). The sections were counterstained with hematoxylin and post-counterstained with bluing reagent ...
-
Dissemination of linezolid-resistance through sex pheromone plasmid transfer in Enterococcs faecalisbioRxiv - Microbiology 2019Quote: ... blots were hybridized with digoxigenin (DIG)-labeled optrA-specific probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Sciences, Germany) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... Barcode-indexed sequencing libraries were generated from reverse-crosslinked ChIP-DNA samples using a Kapa Hyper DNA Library Preparation Kit (Kapa Biosystems-Roche, Basel, Switzerland) and NextFlex UDI adapters (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... The sample DNA underwent end-repair and A-tailing with conditions of 20C for 30 minutes and 65C for 30 minutes (Roche KAPA HyperPrep kit). We ligated native barcodes using 5ul of each barcoded adapter (EXP-NBD196 ...
-
bioRxiv - Microbiology 2022Quote: ... tissues were processed using the Discovery Ultra automated stainer (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics cat#760-159). Specific immunoreactivity was detected using the GenScript U864YFA140-4/CB2093 NP-1 SARS-CoV-2-specific antiserum at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DNA molar concentration of the library was quantified with the KAPA Library Quantification Kit Illumina® Platform (KAPA Biosystems, Woburn, MA, USA). Libraries were sequenced using an Illumina HiSeq® X Ten System with paired-end reads by Beijing Yuanyi Biotechnology Co. ...
-
bioRxiv - Immunology 2022Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNAs as input ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboseErase (v2.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative real time PCRs (qPCRs) were performed in a total volume of 10 μl with Kapa SYBR Fast qPCR kit (KAPA Biosystems, Wilmington, MA) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Cell Biology 2020Quote: ... 2ul of DNA (20 ng of DNA) was added at 10ul of a reaction buffer (Light Cycler Fast Start DNA Master SYBR Green Kit, Roche Diagnostics, Basilea, SWI) and 1% SDS ...
-
bioRxiv - Genomics 2020Quote: ... resuspended in 10 μl of 10 mM tris-HCl (pH = 8.5) and quantified using qPCR with the KAPA Library Quantification Kit (Roche Diagnostics, Diegem, Belgium, KK4854) according to manufacturer’s instructions ...