Labshake search
Citations for Roche :
801 - 850 of 2693 citations for Goat Anti Rat IgG FITC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were probed with the following primary antibodies: rat α-HA (clone 3F10; Roche Applied Sciences), rabbit α-Myc (Cell Signaling Technology) ...
-
bioRxiv - Developmental Biology 2021Quote: ... DIG-labeled antisense or sense probes were synthesized using T7 or T3 RNA polymerase (Roche, 10588423 and 11031171001) and Dig RNA Labeling Mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... In vitro biotin-labeled RNAs (lncAVAN and its antisense RNA) were transcribed with biotin RNA labeling mix (Roche) and T7 RNA polymerase (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... DIG-labeled RNA probes (prepared according to the protocol provided by Roche, Cat. No. 11 277 073 910) or radiolabeled DNA probes and RNA probes were used (Table S5) ...
-
bioRxiv - Neuroscience 2020Quote: ... Digoxigenin (DIG)-labeled probes were synthesized with DIG RNA labeling kit version 12 (SP6/T7) (Roche, Mannheim, Germany). Biotin-labeled probes were synthesized by substitution of DIG RNA labeling mix with biotin RNA labeling mix (Roche ...
-
bioRxiv - Biophysics 2020Quote: ... The 3′ end of the 1,882-nt DNA handle was labeled with dig-ddUTP using terminal transferase (Roche), and the 798-nt DNA handle of the transcript was functionalized with biotin on the 5′ end of the PCR primer ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Genetics 2022Quote: ... purpureum was labeled with DIG using PCR as described in the PCR-DIG Probe Synthesis Kit (Roche Diagnostics). 35S rDNA was labeled with DIG or biotin-16-dUTP (Roche ...
-
bioRxiv - Genetics 2022Quote: ... purpureum gDNA probe was labeled with digoxigenin-11-dUTP (DIG) using a DIG Nick Translation Kit (Roche Diagnostics). Hybridization was performed as described in the Instruction Manual of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were labeled with DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany), and the operating procedures according to the protocol supplied by the manufacturer of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche ...
-
bioRxiv - Genomics 2019Quote: ... DNA was labeled with Fluorolink Cy3-dUTP (Amersham Pharmacia Biotech; red labeling) using a Nick Translation mix (Roche) or with SpectrumGreen direct-labeled dUTP (Vysis ...
-
bioRxiv - Physiology 2020Quote: ... Synthesis of digoxigenin-labeled antisense RNA probes were synthesized using a DIG RNA Labeling Kit (SP6/T7; Roche).
-
bioRxiv - Molecular Biology 2020Quote: Digoxigenin (DIG) or fluorescein labeled RNA probes were made using the DIG RNA labeling kit (Roche, Cat. 11175025910) or fluorescein RNA labeling kit (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hybridized overnight at 40°C with digoxigenin (DIG)-labeled DNA probes in DIG Easy Hyb solution (Roche). After low stringency washes (washing twice with 2× SSC/0.1% SDS at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the DIG-labeled probes were generated according to the manufacturer’s recommendations (Roche Applied Science, Indianapolis, IN, USA). In situ hybridization was performed on embryos from different stages per detailed published protocols (Wilkinson ...
-
bioRxiv - Developmental Biology 2022Quote: Digoxigenin-labeled RNA probes were prepared by in vitro transcription (DIG RNA labeling kit; Roche Diagnostics, Basel, Switzerland). In situ hybridizations were performed on 16μm cryosections that were rehydrated in 1x PBS for 5min ...
-
bioRxiv - Developmental Biology 2023Quote: Digoxigenin-labeled cRNA probes were prepared via in vitro transcription (DIG RNA labeling kit; Roche Diagnostics, Basel, Switzerland) from the Prokr2 template available from Genepaint (https://gp3.mpg.de/viewer/setInfo/MH1790/12) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Both probes were labeled with fluorescein or digoxigenin (DIG) using RNA labeling kit (Roche Applied Science, Mannheim, Germany). The heads of fish at 4 mpf were fixed in 4% paraformaldehyde (PFA ...
-
bioRxiv - Genomics 2023Quote: ... A digoxigenin labeled probe was generated by PCR following the manufacturer’s instructions (PCR DIG Probe Synthesis Kit,Roche). The 993 bp probe (Cd709 chr1 ...
-
bioRxiv - Microbiology 2023Quote: ZIK1 sense and antisense RNA probes labeled with digoxigenin were synthesized using the DIG Northern Starter Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... In vitro transcription of Digoxigenin/Fluorescent-labeled probes was performed using an RNA Labeling Kit (Roche Diagnostics Corporation) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The lcrF transcripts of interest were detected with a DIG-labeled PCR fragment (DIG-PCR nucleotide mix, Roche) amplified with primer pairs for the individually detected according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: Digoxigenin (DIG)-labeled cRNA probes were generated by in vitro transcription using DIG RNA Labeling Mix (Roche Diagnostics), T7 RNA polymerase (Roche Diagnostics) ...
-
bioRxiv - Cell Biology 2020Quote: The rat pancreas was isolated following injection of 1 mg/mL collagenase P (Roche, Indianapolis, IN, USA) through the common bile duct ...
-
bioRxiv - Cell Biology 2023Quote: Adult rat ventricular cardiomyocytes were freshly isolated by Langendorff perfusion with Liberase TM (0.225 mg/mL, Roche) in modified Krebs-Henseleit buffer (135mM NaCl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Developmental Biology 2021Quote: ... Antisense DigoxigeninUTP-labeled RNA probes were synthesized at 37°C using RNA DIG labeling mix per manufacturer’s instructions (Roche) using RNA polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dig-labeled sense and antisense RNA probes for vasa were prepared as described previously [24] (Ambion AM1310, Roche 11277073910). Probes were diluted to 2ng/μL in 100% hybridization solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... The digoxigenin-labeled RNA probes were prepared using a DIG RNA labeling kit according to the manufacturer’s protocol (Roche) using each cDNA clone as the template ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1X Denhardt solution) containing 1μg/ml DIG labeled RNA probes (prepared with a DIG RNA labeling mix, Roche, 11277073910) for overnight at 65°C in a humid chamber ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified by precipitation and one microgram each was labeled by nick translation (Invitrogen or Roche Diagnostics) with Cy3-dUTP (GE ...
-
bioRxiv - Cell Biology 2022Quote: ... The labeled cells were directly harvested in 1ml of RIPA buffer including 1X EDTA-free protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 20,000g for 15 min ...
-
bioRxiv - Genomics 2022Quote: ... The BAC clone (MSMg01-38O12) was labeled by nick-translation with biotin-16-dUTP (Cat# 11093070910, Roche Applied Science) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense and sense digoxogenin (DIG)-labeled RNA probes were generated using the DIG RNA labeling kit (Roche Diagnostics, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... The antisense probe for wdr31 was then transcribed with digoxigenin-labeled UTPs and T7 RNA polymerases (Roche, Basel, Switzerland). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon ...
-
bioRxiv - Genomics 2023Quote: ... accession numbers OY726585 and OY726586) were indirectly labeled by PCR in the presence of biotin-16-dUTP (Roche Diagnostics) detected by streptavidin-Cy3 (Sigma–Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymerase T7 or Sp6 (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used to produce the DIG-labeled single-stranded RNA probes using the DIG RNA labeling kit (Roche, #11175025910). Probes were then cleaned with MegaClear Kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1 nM DIG (Digoxigenin)-labeled Telomere probes in Hybridization solution (DIG Easy Hyb, Roche) at 42°C ...
-
bioRxiv - Microbiology 2021Quote: ... The pellet was suspended in 100 μL of staining solution containing FITC-conjugated Annex-in-V and propidium iodide (Annexin-V-Fluos Staining Kit, Roche Molecular Biochemicals, Germany) and incubated for 15 min at 20 °C ...
-
bioRxiv - Biochemistry 2021Quote: Rat total RNA was prepared from 100 mg of kidneys with the use of TriPure reagent (Roche, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative PCR for rat Cyp7a and reference gene GAPDH was performed using FastStart Essential DNA Green Master (Roche) in an Applied Biosystems theromocycler with 45 cycles of 95°C for 20 seconds ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Neonatal (P1) and adult rat back skin was cut into small pieces then digested with Liberase TL (Roche) for 1 hour at 37°C with constant shaking ...
-
bioRxiv - Microbiology 2020Quote: ... Disruption of the gene was confirmed by Southern hybridization analysis using the total DNA of mutant candidates digested with SalI and the digoxigenin-labeled probes (Roche), the 1.4-kb ApaI fragment carrying SLG_24970 and the 1.3-kb EcoRV fragment carrying kan.