Labshake search
Citations for Roche :
801 - 850 of 1544 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 mM EDTA) in the presence of phosphatase and protease inhibitors (4906837001 and 4693159001, Roche). Cell lysate was subjected to immunoprecipitation with the related antibody and agarose beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) supplemented with protease and phosphatase inhibitor cocktails (Roche, cat#05892791001 and cat#04906837001), was used to homogenize brain tissue as described previously 55 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... At the desired treatment end-point 10 µl of 5 mg/ml MTT labelling Reagent (Roche) was applied per well and plates incubated at 37°C (5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10% glycerol and 5% CHAPS) in the presence of protease inhibitors (cOmpleteTM Protease Inhibitor Cocktail, Roche). Immunoprecipitation of protein extracts was performed using a monoclonal anti-Flag antibody covalently attached to agarose (Anti-FLAG M2 Affinity gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% v/v glycerol) supplemented with HP plus protease inhibitor mix (Serva) and DNase I (Roche). Cell lysates were prepared by sonication and cleared by centrifugation at 80000g at 4°C for 30-45 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... the medium was added with 10 μL of 5 mg/mL MTT solution (Roche, Basel, Switzerland), followed by adding the formazan diluted in about 200 μL of dimethylsulfoxide (Genview ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 mM EDTA) containing 1x protease inhibitor cocktail (cOmplete™, EDTA-free Protease Inhibitor Cocktail, Roche). Cell debris was removed by centrifugation (8,000 g ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... the bill-skin preparation was treated for 5 minutes with 2 mg/mL collagenase P (Roche) in Krebs solution containing (in mM ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM β-ME) supplemented with 5 μM pepstatin A and complete protease inhibitor tablets (Roche). All purification steps were carried out at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM imidazole and 500 μL cOmplete Hig-tag purification Resin (obtained from Roche, ref 05893682001). The mixture was gently shaken at 4°C for 4 h in dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... or pre-extracted for 5 minutes on ice with CSK/0.5% Triton buffer (supplemented with Roche Complete Protease inhibitor and PhosSTOP Phosphatase inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... After the membrane was blocked with 5% BSA (Bovine Serum Albumin Fraction V, Roche Diagnostics, Germany) in TBST buffer (1X Tris-Buffered saline ...
-
bioRxiv - Neuroscience 2022Quote: ... The membranes were blocked for 1 hour at room temperature with 5% blocking agent (Roche Diagnostic) in TBST (100 rpm shaker) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 mM EDTA) containing a protease inhibitor cocktail (cOmplete™, Mini Protease Inhibitor Cocktail, Roche) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 2 ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Molecular Biology 2023Quote: ... and filtered prior to loading onto a prepacked 5 mL cOmpleteTM His-Tag purification column (Roche) equilibrated in HBS ...
-
bioRxiv - Microbiology 2023Quote: ... resuspendend in 10 ml of PBS buffer with 5 μg/ml DNaseI (from bovine pancreas, Roche) and 10 μg/ml lysostaphin and incubated for 20 min at 37°C to allow cell lysis ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStart™ Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Immunology 2023Quote: ... and equal amounts of protein from lysate were incubated with 5 μg anti-FLAG antibody (Roche) overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... and 63 mM adenosine 5’-triphosphate disodium salt trihydrate brought to pH 7.0 (Roche: ATPD-RO), were stored at −20°C.
-
bioRxiv - Cell Biology 2023Quote: ... Each RT-qPCR reaction (10 μl) contained 5 μl of SYBR Green Select Master Mix (Roche), 300 nM of the corresponding forward and reverse primers ...
-
bioRxiv - Genomics 2023Quote: ... final extension 5 min at 62 °C) using the KAPA HiFi HotStart Ready Mix (Kapa Biosystems). Amplified libraries were purified ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.5 supplemented with 5 mM dithiothreitol (DTT) and 1 x cOmplete protease inhibitor cocktail (Roche)) per gram of wet cell paste and incubated for 1 h at 4°C under stirring ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cell Biology 2023Quote: ... 12.5% glycerol) containing 5 mM DTT and protease inhibitor cocktail tablets (PIs, cOmplete EDTA-free, Roche). Cells were lysed by sonication for 3 min (ON 3 sec ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM EDTA pH 8.0) with 1X complete protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche 11697498001) by vortexing ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA was extracted from 5-8 pairs of ovaries using an RNA extraction kit (Roche). 50 ng of total RNA was used to make cDNA using the Transcriptor First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 μL of 5 μM reverse primer and 10 μL of KAPA SYBR FAST (KAPA Biosystems). The qRT-PCR was done in CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM imidazole] containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete™; Roche), and recombinant proteins were purified by immobilized metal affinity chromatography (TALON ...
-
bioRxiv - Biophysics 2024Quote: ... 5% glycerol) per 1 L of cells with one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were lysed using a Misonix Sonicator 3000 (110 W for 2 min total ON-time ...
-
bioRxiv - Biochemistry 2024Quote: ... in 5 % BSA in room temperature for 1 hour followed by 2.5 ug/ml DAPI (Roche) for 20 minutes ...
-
bioRxiv - Genomics 2024Quote: ... We reconstituted 5 mg of the enzyme Liberase™ (Thermolysin Medium) Research Grade (LIBTM-RO Roche) in 2 mL of PBS (to give a stock concentration of 2.5 mg/ml ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...