Labshake search
Citations for Roche :
801 - 850 of 7931 citations for 6 Iodo 2 methyl 4H 3 1 benzoxazin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: A subcutaneous dose (1 or 2 mg/kg of weight) of diazepam (DZPM, Valium ®, Roche; México) or saline solution (SAL ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with 1 ml lysis buffer (0.5 % Nonident-P40, 2 % protease inhibitor cocktail (Roche, Switzerland) and 1 % phosphatase inhibitor cocktails I and II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... were lysed in 100 µL or 300 mL RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% IGEPAL CA-630, 0.25% Na-deoxycholate, 2 mM EDTA, 0.1% SDS, Roche cOmplete™ Mini protease Inhibitor Cocktail) ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM tris(2-carboxyethyl)phosphine (TCEP) and protease inhibitor (cOmplete EDTA-free Protease Inhibitor Cocktail, Roche)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2019Quote: ... 4 °C) the cleared supernatants were diluted 1 time using water containing 1x cOmplete ™ EDTA-free protease inhibitor (Roche). Protein extract was incubated overnight with anti-HA antibodies (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4°C with anti-Digoxigenin antibody coupled to alkaline phosphatase (Roche, 11207733910, used at 1/4000). The last day ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the soluble fraction was incubated for 1 h at 4°C with beads crosslinked to mouse anti-GFP antibody (Roche). Resulting Immunoprecipitates were washed three times with lysis buffer and protein eluted with RapiGest surfactant (Waters ...
-
Elevated Hoxb5b expands vagal neural crest pool and blocks enteric neuronal development in zebrafishbioRxiv - Developmental Biology 2021Quote: ... Probed embryos were blocked for 1-2 hours at ambient temperature in 5% Goat sera in PBST before detection overnight (∼16 hours) at 4°C using an anti-Digoxigenin-Fab fragments conjugated to Alkaline Phosphatase enzymes (1:1000 dilution, Roche) in 5% Goat Sera in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... the sections were incubated overnight at 4 °C in digoxigenin antibodies conjugated to horseradish peroxidase (anti-digoxigenin-POD; Fab fragment; 1:100; Roche), rinsed in TBS (0.1 M Tris-HCl with 0.9% NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated overnight at +4 °C with the antibody anti-digoxigenin-AP Fab fragment (#11093274910, Roche, 1:1000) diluted in blocking solution in a humidity chamber ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at 4°C with primary antibody for rat anti-HA (1:200; 12013819001, RRID:AB_390917, Roche, Basel, Switzerland), rabbit anti-GFP (1:200 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated overnight at 4°C with sheep anti-DIG alkaline phosphatase conjugated antibody (1:2,000; Roche Applied Sciences). Sections were washed thrice with PTW buffer and twice with coloration buffer (100 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-Green Fluorescent Protein overnight at 4°C (Clones 7.1 and 13.1; 1:50 dilution, Roche, Mannheim, Germany) and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10 ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... isolated from each cell line was collected by centrifugation (30 000 x g, 4°C, 10 min) and resuspend in 1 x PBS supplemented with protease inhibitors (Roche) to protein concentration 1.5 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sonicated samples were centrifuged and the supernatant (soluble fraction) was incubated for 1 h at 4°C with beads crosslinked to anti-GFP antibody (11814460001; Roche) or to M2 anti-FLAG antibody (F1804 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed once with PBS and resuspend with Tris-HCl containing 4 mM EDTA and 1× complete protease inhibitor cocktail (Roche). Dounce homogenizer is used to fractionate the cell membranes and then 3 min 600 g centrifugation was used to obtain Post-Nuclear Supernatants (PNS) ...
-
bioRxiv - Genomics 2023Quote: One hundred mg of 14-day-old seedlings were ground and nuclei were isolated with 4°C Buffer (0,25M Sucrose, 10mM Tris-HCl, 10mM MgCL2, 1% Triton, 5mM ß- mercaptoethanol) containing proteinase inhibitor cocktail (Roche) and filtered in 63 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...